Identification of MiR-223 Associated with Diagnosis in Ectopic Pregnancy

Figures & data

Table 1 The Sequence of PCR Primers

miRNA	Primers for cDNA Synthesis	Primers for qPCR
U6 (internal reference)	CGAATTTGCGTGTCATCCTTG	GCTTCGGCAGCACATATACTA
Universal reverse primers for miRNA		CGAATTTGCGTGTCATCCTTG
hsa-miR-223-5p	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTCA	CGCGCGTGTATTTGACAAGC
Universal reverse primers for miRNA		AGTGCAGGGTCCGAGGTATT
hsa-miR-223-3p	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGGGT	GCGCGTGTCAGTTTGTCAAAT
Universal reverse primers for miRNA		AGTGCAGGGTCCGAGGTATT

Figure 1 Study workflow.

Figure 2 Differentially expressed miRNAs. (A) Volcano map showing the miRNAs molecules obtained from the differential analysis of the GSE44731 dataset, red represents upregulated genes and blue represents downregulated genes. (B) Heat map showing the miRNA molecules obtained from the differential analysis of the GSE44731 dataset.

Figure 3 ROC for Differentially expressed miRNA molecules. (A) miRNA-410/miRNA-1/miRNA-133b/miRNA-487b; (B) miRNA-379/miRNA-144/miRNA-16/miRNA-25/miRNA-409-3p; (C) miRNA-376a/miRNA-645-3p/miRNA-376c/miRNA-136/miRNA-377/miRNA-127-3p; (D) miRNA-30a/miRNA-196b/MiR-223/.

Table 2 BP (Biological Process) of GSE44731 Dataset

Ontology	ID	Description	GeneRatio	BgRatio	p value	p Adjust	q value
BP	GO:0032271	Regulation of protein polymerization	11/199	218/18,670	2.30e-05	0.030	0.026
BP	GO:0045070	Positive regulation of viral genome replication	5/199	35/18,670	3.27e-05	0.030	0.026
BP	GO:0048268	Clathrin coat assembly	4/199	18/18,670	3.41e-05	0.030	0.026
BP	GO:1903902	Positive regulation of viral life cycle	6/199	61/18,670	4.64e-05	0.030	0.026
BP	GO:0030833	Regulation of actin filament polymerization	9/199	162/18,670	6.15e-05	0.030	0.026
BP	GO:0072583	Clathrin-dependent endocytosis	5/199	40/18,670	6.36e-05	0.030	0.026
BP	GO:0019886	Antigen processing and presentation of exogenous peptide antigen via MHC class II	7/199	98/18,670	8.58e-05	0.030	0.026
BP	GO:0032799	Low-density lipoprotein receptor particle metabolic process	4/199	23/18,670	9.46e-05	0.030	0.026
BP	GO:0002495	Antigen processing and presentation of peptide antigen via MHC class II	7/199	101/18,670	1.04e-04	0.030	0.026
BP	GO:0002504	Antigen processing and presentation of peptide or polysaccharide antigen via MHC class II	7/199	102/18,670	1.10e-04	0.030	0.026

Table 3 CC (Cellular Component) of GSE44731 Dataset

Ontology	ID	Description	GeneRatio	BgRatio	p value	p Adjust	q value
CC	GO:0005925	Focal adhesion	22/208	405/19,717	3.62e-10	6.77e-08	5.62e-08
CC	GO:0005924	Cell–substrate adherens junction	22/208	408/19,717	4.17e-10	6.77e-08	5.62e-08
CC	GO:0030055	Cell–substrate junction	22/208	412/19,717	5.00e-10	6.77e-08	5.62e-08
CC	GO:0030125	Clathrin vesicle coat	4/208	29/19,717	2.32e-04	0.022	0.018
CC	GO:0000118	Histone deacetylase complex	5/208	58/19,717	3.62e-04	0.022	0.018
CC	GO:0030120	Vesicle coat	5/208	58/19,717	3.62e-04	0.022	0.018
CC	GO:0019897	Extrinsic component of plasma membrane	8/208	165/19,717	3.74e-04	0.022	0.018
CC	GO:0043025	Neuronal cell body	14/208	497/19,717	8.44e-04	0.040	0.033
CC	GO:0030136	Clathrin-coated vesicle	8/208	188/19,717	8.83e-04	0.040	0.033
CC	GO:0030132	Clathrin coat of coated pit	3/208	20/19,717	0.001	0.042	0.035

Table 4 MF (Molecular Function) of GSE44731 Dataset

Ontology	ID	Description	GeneRatio	BgRatio	p value	p Adjust	q value
MF	GO:0045296	Cadherin binding	16/203	331/17,697	1.44e-06	6.13e-04	5.47e-04
MF	GO:0050839	Cell adhesion molecule binding	18/203	499/17,697	1.87e-05	0.004	0.004
MF	GO:1902936	Phosphatidylinositol bisphosphate binding	8/203	110/17,697	3.93e-05	0.006	0.005
MF	GO:0017016	Ras GTPase binding	15/203	429/17,697	1.34e-04	0.012	0.011
MF	GO:0003779	Actin binding	15/203	431/17,697	1.41e-04	0.012	0.011
MF	GO:0031267	Small GTPase binding	15/203	443/17,697	1.89e-04	0.013	0.012
MF	GO:0005543	Phospholipid binding	14/203	427/17,697	4.28e-04	0.026	0.023
MF	GO:1901981	Phosphatidylinositol phosphate binding	8/203	161/17,697	5.48e-04	0.029	0.026
MF	GO:0005546	Phosphatidylinositol-4,5-bisphosphate binding	5/203	75/17,697	0.002	0.067	0.060
MF	GO:0048156	Tau protein binding	4/203	45/17,697	0.002	0.067	0.060

Table 5 KEGG (Kyoto Encyclopedia of Genes and Genomes) of GSE44731 Dataset

Ontology	ID	Description	GeneRatio	BgRatio	p value	p. Adjust	q value
KEGG	hsa05100	Bacterial invasion of epithelial cells	10/111	77/8076	8.12e-08	1.70e-05	1.56e-05
KEGG	hsa05135	Yersinia infection	10/111	137/8076	1.71e-05	0.002	0.002
KEGG	hsa04530	Tight junction	10/111	169/8076	1.03e-04	0.007	0.007
KEGG	hsa04810	Regulation of actin cytoskeleton	11/111	218/8076	1.91e-04	0.010	0.009
KEGG	hsa05132	Salmonella infection	11/111	249/8076	5.96e-04	0.025	0.023
KEGG	hsa04670	Leukocyte transendothelial migration	7/111	114/8076	9.42e-04	0.033	0.030
KEGG	hsa04510	Focal adhesion	9/111	201/8076	0.002	0.048	0.045
KEGG	hsa05131	Shigellosis	10/111	246/8076	0.002	0.048	0.045
KEGG	hsa01210	2-Oxocarboxylic acid metabolism	3/111	19/8076	0.002	0.048	0.045
KEGG	hsa04144	Endocytosis	10/111	252/8076	0.002	0.050	0.046

Figure 4 GO and KEGG enrichment analysis of DEM target genes. (A) Biological processes enriched (BPs) in the GSE44731 dataset; (B) Cell compositions enriched in GSE44731 dataset (CCs); (C) Molecular functions enriched in the GSE44731 dataset (MFs); (D) Signaling pathways enriched in the GSE44731 dataset (KEGG).

Table 6 GSEA of miRNA

Category	Subcategory	Enrichment	P-value	P-Adjusted	Q-value	Observed
Pathways (KEGG)	Prion diseases	Depleted	0.0001	0.0161	0.0161	81
Pathways (KEGG)	Th1 and Th2 cell differentiation	Depleted	0.0001	0.0161	0.0161	155
Pathways (KEGG)	NF-kappa B signaling pathway	Depleted	0.0003	0.0362	0.0362	187
Pathways (KEGG)	Chemokine signaling pathway	Depleted	0.0006	0.0458	0.0458	237
Gene Ontology (miRWalk)	GO0006351 transcription DNA dependent	Depleted	0.0000	0.0005	0.0005	88
Gene Ontology (miRWalk)	GO0005730 nucleolus	Depleted	0.0000	0.0002	0.0002	86
Gene Ontology (miRWalk)	GO0005524 ATP binding	Depleted	0.0004	0.0292	0.0292	84
Gene Ontology (miRWalk)	GO0003677 DNA binding	Depleted	0.0000	0.0006	0.0006	82

Figure 5 GSEA of miRNAs: (A) Th1 and Th2 cell differentiation; (B) Prion diseases; (C) NF-κB signaling pathway; (D) Chemokine signaling pathway; (E) DNA binding; (F) ATP binding; (G) nucleolus; (H) transcription DNA dependent.

Figure 6 Network construction. (A) PPI network of target genes; (B) miRNA–mRNA interaction network; (C) miRNA–lncRNA interaction network; (D) ceRNA network.

Figure 7 Expression of miRNA-223 in both groups of cells (ns, p≥0.05; *p <0.05).