Blockage of both the extrinsic and intrinsic pathways of diazinon-induced apoptosis in PaTu cells by magnesium oxide and selenium nanoparticles

Figures & data

Table 1 Intrinsic and extrinsic pathway proteins, abbreviations, accession numbers, and primers used for real-time RT-PCR

Gene name	Gene symbol	Accession number	Primer sequence (5′–3′)
Intrinsic pathway proteins
BCL2-associated X protein	BAX	NM_001291428	F: AACTGATCAGAACCATCATGGGC
			R: CTTGGATCCAGCCCAACAGCC
B-cell CLL/lymphoma 2	BCL2	NM_000633	F: TATAAGCTGTCGCAGAGGGGCTAC
			R: TGGGAGGAGAAGATGCCCGGT
Cytochrome c, somatic	CYCS	NM_018947.5	F: TCCCAGTCACTACTTCCTTCCT
			R: CAACACTTGGCTGTAGCAATG
Caspase-3, apoptosis-related cysteine peptidase	CASP3	NM_004346	F: ACTTTTCATTATTCAGGCCTGCCG
			R: CATACAAGAAGTCGGCCTCCAC
Caspase-9, apoptosis-related cysteine peptidase	CASP9	NM_001229	F: ACCCCAAAGCTTTCCTGCC
			R: TCTGTCACTGGCAGAGAAAGAGCA
Tumor protein p53	TP53	NM_000546	F: CATGTGCTCAAGACTGGCGCTAA
			R: CGCTCCCAGCCCGAACGCAA
Baculoviral IAP repeat containing 5	BIRC5	NM_001012270	F: GATTAGCCTCTGTCTCGGTG
			R: ACAAAGTTCTGCTCAGGGTG
Extrinsic pathway proteins
Caspase-8, apoptosis-related cysteine peptidase	CASP8	NM_001080124	F: GGATGATGACATGAACCTGCTGG
			R: TTGTTGATTTGGGCACAGACTCTTT
Fas cell surface death receptor	FAS	NM_000043	F: GAAGCGTATGACACATTGATTAAAGATCTC
			R: CACTCTAGACCAAGCTTTGGATTTCATTT
TNF receptor-associated factor 2	TRAF2	NM_021138	F: CGTGCAGAGCGGCCTAGACCT
			R: CAGCTCGCGCAGGAGCTC
Tumor necrosis factor receptor superfamily, member 1A	TNFRSF1A (TNFR1)	NM_001065	F: CATTATTGGAGTGAAAACCTTT
			R: TGGCAGGTGCACACGGTGTT
Fas (TNFRSF6)-associated via death domain	FADD	NM_003824	F: GCTCTTGTCGATTTCCTGTAGTGAATC
			R: TCTGTCCTCGGCTCGCTGG
Fas ligand (TNF superfamily, member 6)	FASLG	NM_000639	F: CAACAGGGTCCCGTCCTTGACA
			R: AGCTGGCACTGCTGTCCACCC
Tumor necrosis factor receptor superfamily, member 10a	TNFRSF10A (DR4)	NM_003844.3	F: AGTAACAAATTCCATAAACACAATTAGC
			R: GACATGGTTGTCAGGACGAGCTAG
CASP8 and FADD-like apoptosis regulator	CFLAR (FLIP)	NM_001127183	F: TCTGGAGGAGAAGAACTTTGTG
			R: TGGCAGTGTAGTAGCTGTCGT
Glyceraldehyde-3-phosphate dehydrogenase	GAPDH	NM_001256799	F: GATGCTGCGCCTGCGGTAGA
			R: CATTGCTGATGATCTTGAGGCTGTT

Abbreviations: RT, reverse transcription; PCR, polymerase chain reaction.

Figure 1 The inhibitory effects of cell viability on treatment with various concentrations of DZ in the PaTu cell line compared to untreated sample (Con).

Notes: The median inhibitory concentration (IC₅₀) of DZ was 1,300 µM. Results are expressed as mean ± SEM from three independent experiments. *P<0.05 and ***P<0.001 indicate statistically significant differences between the mean of values obtained with treated vs untreated cells.

Abbreviations: Con, control; DZ, diazinon; SEM, standard error of mean.

Figure 2 Effects of various concentrations of MgO NPs (A) and Se NPs (B) on cell viability in the PaTu cell line compared to untreated sample (Con).

Notes: The nontoxic concentrations of MgO and Se NPs as selective concentrations for counteraction of DZ-induced cytotoxicity in PaTu cells were 100 and 0.01 µg/mL, respectively. Results are expressed as mean ± SEM from three independent experiments. **P<0.01 and ***P<0.001 indicate statistically significant differences between the mean of values obtained with treated vs untreated cells.

Abbreviations: Con, control; DZ, diazinon; MgO NPs, magnesium oxide nanoparticles; Se NPs, selenium nanoparticles; SEM, standard error of mean.

Figure 3 Effects of MgO NPs, Se NPs, and their combination on releasing insulin (A), proinsulin (B), and C-peptide (C) in the PaTu cell line in the presence of DZ.

Notes: Data are expressed as mean ± SEM. Significantly different from control at ^aP<0.05, ^aaP<0.01. Significantly different from DZ at ^bP<0.05, ^bbP<0.01, ^bbbP<0.001.

Abbreviations: Con, control; DZ, diazinon; MgO NPs, magnesium oxide nanoparticles; Se NPs, selenium nanoparticles; SEM, standard error of mean.

Figure 4 Effects of MgO NPs, Se NPs, and their combination on mitochondrial activity (A) and MMP (B) in the PaTu cell line in the presence of DZ.

Notes: Data are expressed as mean ± SEM. Significantly different from control at ^aP<0.05, ^aaP<0.01, ^aaaP<0.001. Significantly different from DZ at ^bP<0.05.

Abbreviations: Con, control; DZ, diazinon; MgO NPs, magnesium oxide nanoparticles; Se NPs, selenium nanoparticles; MMP, mitochondrial membrane potential; SEM, standard error of mean.

Figure 5 Effects of MgO NPs, Se NPs, and their combination on caspase-3 (A) and -9 activities (B) in the PaTu cell line in the presence of DZ.

Notes: Data are expressed as mean ± SEM. Significantly different from control at ^aP<0.05, ^aaP<0.01, ^aaaP<0.001. Significantly different from DZ at ^bP<0.05, ^bbbP<0.001.

Abbreviations: Con, control; DZ, diazinon; MgO NPs, magnesium oxide nanoparticles; Se NPs, selenium nanoparticles; SEM, standard error of mean.

Figure 6 Effects of MgO NPs, Se NPs, and their combination on TTM levels in the PaTu cell line in the presence of DZ.

Notes: Data are expressed as mean ± SEM. Significantly different from control at ^aP<0.05. Significantly different from DZ at ^bP<0.05, ^bbP<0.01.

Abbreviations: Con, control; DZ, diazinon; MgO NPs, magnesium oxide nanoparticles; Se NPs, selenium nanoparticles; TTM, total thiol molecules; SEM, standard error of mean.

Figure 7 (A) Representative fluorescence microscopic images of PaTu cell line double stained with AO and EB after 24 hours of exposure to articles MgO NPs, Se NPs, and their combination in the presence of DZ. (B) Quantification of viable and dead cells according to percentage of fluorescence intensity of AO/EB.

Notes: (A) Viable cells appear uniformly green; early apoptotic cells show characteristic loss of membrane integrity and chromatin condensation, stain bright green to yellow; late apoptotic cells incorporate EB and therefore stain yellow orange and show condensed and often fragmented nuclei; necrotic cells are orange red in appearance. Images of the fields were acquired at a magnification of ×20. (B) AO is a vital dye and stains both live and dead cells, but EB stains only cells that have lost membrane integrity. So, an increase in the percentage of EB-stained cells indicates an increase in cell damage (apoptosis and necrosis).

Abbreviations: Con, control; DZ, diazinon; MgO NPs, magnesium oxide nanoparticles; Se NPs, selenium nanoparticles; AO, acridine orange; EB, ethidium bromide; NPs, nanoparticles.

Table 2 Relative mRNA expression using real-time PCR for expression of intrinsic and extrinsic pathway proteins in PaTu cells exposed 24 hours to DZ and NPs compared to nontreated control cells

Gene symbol	Experimental groups (relative fold change ± SEM)
	DZ	NPs-treated groups
		DZ + MgO	DZ + Se	DZ + MgO + Se
Intrinsic pathway proteins
BIRC5	0.86±0.04	6.28±0.31*	6.73±0.34*	6.68±0.33*
BCL2	0.59±0.03	1.73±0.09*	2.73±0.14*	1.58±0.08*
BAX	5.46±0.27	2.89±0.15*	0.17±0.01*	0.15±0.01*
CYCS	68.12±3.41	4.11±0.21*	58.49±2.93	47.84±2.39**
CASP3	1.64±0.08	1.26±0.06***	1.55±0.08	1.14±0.06**
CASP9	5.72±0.29	1.97±0.10*	5.54±0.28	5.56±0.28
TP53	1.53±0.08	0.70±0.04*	1.42±0.07	0.86±0.04*
Extrinsic pathway proteins
CASP8	1.45±0.07	1.13±0.06***	1.05±0.05**	1.33±0.07
FAS	2.16±0.11	0.52±0.03*	0.93±0.05*	1.61±0.08**
TRAF2	2.31±0.12	0.86±0.04*	0.84±0.04*	1.97±0.10
TNFRSF1A (TNFR1)	1.55±0.08	0.38±0.02*	0.68±0.03*	0.68±0.03*
FADD	0.67±0.03	0.34±0.02*	0.91±0.05**	0.48±0.02***
FASLG	0.69±0.04	0.57±0.03	0.58±0.03	0.47±0.02**
TNFRSF10A (DR4)	0.52±0.03	0.37±0.02***	0.74±0.04**	0.52±0.03
CFLAR (FLIP)	1.78±0.09	1.30±0.07***	2.87±0.14*	0.81±0.04*

Notes: GAPDH is the housekeeping gene control. Results are expressed as mean ± SEM from three independent experiments.

* P<0.001,

** P<0.01, and

*** P<0.05 indicate significantly different from DZ.

Abbreviations: SEM, standard error of mean; DZ, diazinon; NPs, nanoparticles; MgO, magnesium oxide; Se, selenium; PCR, polymerase chain reaction.