Electrospun chitosan-graft-poly (ɛ-caprolactone)/poly (ɛ-caprolactone) nanofibrous scaffolds for retinal tissue engineering

Figures & data

Table 1 Characterization of CS-PCL

Sample	MFRa	Yield (%)b	Mw (×10^4)c	PDIc	CLnd
CS-PCL	12	79	4.86	3.43	2.7

Notes:

a Moral feed ratio of ɛ-CL to glucosamine units;

b Yield (%) = [(W_CS-PCL)/(W_CL + W_CS)] × 100%;

c Measured by GPC; polystyrene samples were used as standard;

d Average number of ɛ-CL units per glucosamine unit in CS, CL_n = A_[(a)/2]/A_{[(3, 4, 5, 6, 6′)/5]}, calculated from ¹H NMR.

Abbreviations: ¹H NMR, proton nuclear magnetic resonance; CL, caprolactone; CS, chitosan; CS-PCL, cationic chitosan-graft-poly (ɛ-caprolactone); GPC, gel permeation chromatography; MFR, moral feed ratio; Mw, molecular weight; PDI, polydispersity index.

Table 2 Primers used for quantitative qPCR

Genes	Accession number	Forward (5′–3′)	Reverse (5′–3′)	Annealing temperature (°C)	Product size (base pairs)
Nestin	NM_016701	aactggcacctcaagatgt	tcaagggtattaggcaagggg	60	235
Vimentin	NM_011701	tggttgacacccactcaaaa	gcttttggggtgtcagttgt	60	269
Ki-67	X82786	cagtactcggaatgcagcaa	cagtcttcaggggctctgtc	60	170
β3-tubulin	NM_023279	cgagacctactgcatcgaca	cattgagctgaccagggaat	60	152
Map2	NM_001039934	agaaaatggaagaaggaatgactg	acatggatcatctggtaccttttt	60	112
Recoverin	NM_009038	atggggaatagcaagagcgg	gagtccgggaaaaacttggaata	60	179
Rhodopsin	NM_145383	tcaccaccaccctctacaca	tgatccaggtgaagaccaca	60	216
PKC-α	NM_011101	cccattccagaaggagatga	ttcctgtcagcaagcatcac	60	212
GFAP	NM_010277	agaaaaccgcatcaccattc	tcacatcaccacgtccttgt	60	184
β-actin	NM_007393	agccatgtacgtagccatcc	ctctcagctgtggtggtgaa	60	152
Caspase 3	NM_009810	aaggagcagctttgtgtgtgt	cgcctctgaagaagctagtca	60	107

Abbreviations: GFAP, glial fibrillary acidic protein; PKC-α, protein kinase C alpha; qPCR, polymerase chain reaction.

Figure 1 Proton nuclear magnetic resonance spectra of CS-PCL (A), PCL (B), and CS (C).

Abbreviations: CS, chitosan; CS-PCL, cationic chitosan-graft-poly (ɛ-caprolactone); DMSO, dimethyl sulfoxide; PCL, polycaprolactone.

Figure 2 Fourier-transform infrared spectra of CS-PCL (A), PCL (B), and CS (C).

Abbreviations: CS, chitosan; CS-PCL, cationic chitosan-graft-poly (ɛ-caprolactone); PCL, polycaprolactone.

Figure 3 Scanning electron microscopy images of electrospun nanofibous scaffolds prepared from different CS-PCL/PCL weight ratios: CS-PCL (A), CS-PCL/PCL (80/20) (B), CS-PCL/PCL (60/40) (C), CS-PCL/PCL (40/60) (D), CS-PCL/PCL (20/80) (E), and PCL (F).

Abbreviations: CS-PCL, cationic chitosan-graft-poly (ɛ-caprolactone); PCL, polycaprolactone.

Table 3 Fiber diameter, porosity, and water contact angle properties of different electrospun nanofibrous scaffolds

Sample	Fiber diameter	Porosity	WCA
CS-PCL/PCL (40/60)	656 ± 53 nm	77% ± 6%	0°
CS-PCL/PCL (20/80)	775 ± 35 nm	84% ± 4%	0°
PCL	925 ± 42 nm	89% ± 3%	134° ± 2°

Abbreviations: CS-PCL, cationic chitosan-graft-poly (ɛ-caprolactone); PCL, polycaprolactone; WCA, water contact angle.

Table 4 Atomic ratios of carbon, nitrogen, and oxygen on the surface of CS-PCL/PCL (40/60), CS-PCL/PCL (20/80), and PCL nanofibrous scaffolds determined by x-ray photoelectron spectroscopy

Nanofibers	Carbon ratio (%)	Nitrogen ratio (%)	Oxygen ratio (%)
CS-PCL/PCL (40/60)	74.38	0.31	25.31
CS-PCL/PCL (20/80)	74.64	0.24	25.12
PCL	75.54	0	24.46

Abbreviations: CS-PCL, cationic chitosan-graft-poly (ɛ-caprolactone); PCL, polycaprolactone.

Figure 4 Zeta-potential curve for electrospun nanofibrous scaffolds (n = 5).

Abbreviation: CS-PCL, cationic chitosan-graft-poly (ɛ-caprolactone).

Figure 5 Fluorescent micrograph of mRPC density on CS-PCL/PCL (40/60) (A–C), CS-PCL/PCL (20/80) (D–F), PCL (G–I) nanofibrous scaffolds, and the cell culture plates (TCPS) (J–L) on day 1, 4, and 7 after incubation (green = endogenous GFP expression). Scale bar: 100 μm.

Abbreviations: CS-PCL, cationic chitosan-graft-poly (ɛ-caprolactone); GFP, green fluorescent protein; PCL, polycaprolactone; mRPC, mouse retinal progenitor cell; TCPS, tissue culture polystyrene.

Figure 6 Analysis of mRPC proliferation on PCL and CS-PCL/PCL nanofibrous scaffolds and the cell culture plates (TCPS), measured by MTS assay.

Notes: Bar represents mean ± standard deviation (n = 4). *P < 0.05.

Abbreviations: CS-PCL, cationic chitosan-graft-poly (ɛ-caprolactone); mRPC, mouse retinal progenitor cell; MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium; OD, optical density; PCL, polycaprolactone; TCPS, tissue culture polystyrene.

Figure 7 Scanning electron microscopy images of mRPCs grown on CS-PCL/PCL (20/80) (A–C) and PCL (D–F) nanofibrous scaffolds on day 1 (A, D), 4 (B, E), and 7 (C, F) after incubation.

Abbreviations: CS-PCL, cationic chitosan-graft-poly (ɛ-caprolactone); mRPC, mouse retinal progenitor cell; PCL, polycaprolactone.

Figure 8 Gene expression profile of mRPCs grown on CS-PCL/PCL (20/80) and PCL scaffolds on day 4 and 7.

Note: The error bars show standard deviation (n = 3).

Abbreviations: CS-PCL, cationic chitosan-graft-poly (ɛ-caprolactone); GFAP, glial fibrillary acidic protein; mRPC, mouse retinal progenitor cell; PCL, polycaprolactone; PKC-α, protein kinase C alpha.