Biomimetic intrafibrillar mineralized collagen promotes bone regeneration via activation of the Wnt signaling pathway

Figures & data

Figure 1 The macroscopic and surface topography images.

Note: HA (A, D), EMC (B, E), and IMC (C, F) visualized by SEM and AFM, individually.

Abbreviations: AFM, atomic force microscopy; EMC, extrafibrillar mineralized collagen; HA, nano-hydroxyapatite; IMC, intrafibrillar mineralized collagen; SEM, scanning electron microscopy.

Figure 2 Surgical procedures.

Notes: (A) Critical-sized defects created on a rat femur. (B) Bone scaffold materials implanted into the defect.

Table 1 Primers for qRT-PCR

Gene	Forward primer (5′–3′)	Reverse primer (5′–3′)
GAPDH	GGTGAAGGTCGGAGTCAACGG	GGTCATGAGTCCTTCCACGAT
Wnt5a	TCTCAGCCCAAGCAACAAGG	GCCAGCATCACATCACAACAC
β-Catenin	GCTACTGTTGGATTGATTCGAAATC	CCCTGCTCACGCAAAGGT
Axin2	CCCCAAAGCAGCGGTGC	GCGTGGACACCTGCCAG

Abbreviation: qRT-PCR, quantitative real-time transcription polymerase chain reaction.

Figure 3 Analysis of in vivo bone regeneration effects of different bone scaffold materials.

Notes: (A) Representative µ-CT and HE staining images of defect regions after implantation with blank, HA, EMC, and IMC scaffolds for 10 weeks. (B) New BV relative to the TV within the defect region from different groups based on µ-CT analysis. (C) Semiquantitative analysis of new bone based on histologic examination. *P<0.05 vs IMC; &P<0.05 vs EMC; ^#P<0.05 vs all of the other groups.

Abbreviations: µ-CT, micro-computed tomography; BV, bone tissue volume; EMC, extrafibrillar mineralized collagen; HA, nano-hydroxyapatite; IMC, intrafibrillar mineralized collagen; NB, new bone; OB, old bone; S, scaffold materials; TV, total tissue volume; F, fibrous tissue.

Table 2 Numbers of differentially expressed genes at days 7 and 14

	Numbers of differentially significant genes
	Upregulated	Downregulated	Total
Day 7	252	249	501
Day 14	507	504	1,011

Figure 4 The volcano plots of differentially expressed genes between IMC and blank groups.

Notes: (A) At day 7. (B) At day 14. Red points indicate mRNAs with a fold change of ≥2.0 and a P-value ≤0.05. Blue points indicate mRNAs with a fold change of ≤2.0 and a P-value of ≤0.05.

Abbreviation: IMC, intrafibrillar mineralized collagen.

Table 3 Overexpressed GO categories of biological processes at day 7

Term ID and description	Count	P-value
Downregulated
GO:0050731–positive regulation of peptidyl-tyrosine phosphorylation	12	2.64E–06
GO:0019221–cytokine-mediated signaling pathway	10	2.10E–05
GO:0001666–response to hypoxia	13	0.000331
GO:0006886–intracellular protein transport	8	0.00646
GO:0050918–positive regulation of protein kinase B signaling	8	0.0144
GO:0045779–negative regulation of bone resorption	4	0.0351
GO:0006508–proteolysis	5	0.0419
Upregulated
GO:0006954–inflammatory response	9	2.04E–05
GO:0009611–response to wounding	15	4.73E–05
GO:0002526–acute inflammatory response	13	0.000158
GO:0006955–immune response	15	0.000827
GO:0001525–angiogenesis	11	0.000985
GO:0019882–antigen processing and presentation	6	0.00451
GO:0008284–positive regulation of cell proliferation	10	0.00508
GO:0006953–acute-phase response	5	0.00797
GO:0042088–T-helper 1 type immune response	6	0.0105
GO:0030101–natural killer cell activation	4	0.0122
GO:0007155–cell adhesion	7	0.0164
GO:0042060–wound healing	5	0.0288
GO:0051092–positive regulation of NF-kappaB transcription factor activity	5	0.0394
GO:0007599–hemostasis	3	0.0402
GO:0007568–aging	4	0.0413

Abbreviation: GO, gene ontology.

Table 4 Overexpressed GO terms of biological processes at day 14

Term ID and description	Count	P-value
Downregulated
GO:0071347–cellular response to interleukin-1	17	2.24E–06
GO:0001913–T cell-mediated cytotoxicity	11	4.51E–05
GO:0070374–positive regulation of ERK1 and ERK2 cascade	7	0.000271
GO:0003009–skeletal muscle contraction	4	0.000431
GO:0002548–monocyte chemotaxis	5	0.00227
GO:0060389–pathway-restricted SMAD protein phosphorylation	3	0.00316
GO:0048535–lymph node development	4	0.0164
GO:0014823–response to activity	3	0.0287
GO:0006816–calcium ion transport	5	0.0354
GO:0045453–bone resorption	3	0.0359
GO:0034141–positive regulation of toll-like receptor 3 signaling pathway	2	0.0477
Upregulated
GO:0048856–anatomical structure development	21	3.37E–05
GO:0032502–developmental process	18	8.16E–05
GO:0048468–cell development	17	0.000871
GO:0016055–Wnt signaling pathway	11	0.000960
GO:0001501–skeletal system development	13	0.00104
GO:0007399–nervous system development	14	0.00116
GO:0030154–cell differentiation	9	0.00189
GO:005087–neurological system process	11	0.0182
GO:0060348–bone development	10	0.00209
GO:0090263–positive regulation of canonical Wnt signaling pathway	4	0.00237
GO:0060349–bone morphogenesis	5	0.00366
GO:0030316–osteoclast differentiation	7	0.00482
GO:0001503–ossification	5	0.00578
GO:0031100–organ regeneration	5	0.00764
GO:0016477–cell migration	7	0.0103
GO:0060070–canonical Wnt signaling pathway	4	0.0156
GO:0030111–regulation of Wnt receptor signaling pathway	4	0.0211
GO:0030278–regulation of ossification	3	0.0225
GO:0051216–cartilage development	4	0.0241
GO:0007218–neuropeptide signaling pathway	3	0.0273
GO:0007266–Rho protein signal transduction	3	0.0288
GO:0030282–bone mineralization	4	0.0304
GO:0046578–regulation of Ras protein signal transduction	3	0.0417

Abbreviation: GO, gene ontology.

Table 5 List of differentially expressed genes (P<0.05) belonging to functionally relevant GO terms (positive value indicates upregulated genes)

Gene symbol	Gene name	Fold change
Skeletal development
Acan	Aggrecan 1	6.1
Axin2	Axin2	4.3
Bglap	Bone γ-carboxyglutamate(gla) protein (osteocalcin)	3.4
Bmp2	Bone morphogenetic protein 2	2.7
Bmpr1a	Bone morphogenetic protein receptor, type IA	3.6
COL1A2	Procollagen, type, 1 α2	2.8
COL3A1	Collagen, type XIII, α1	3.1
DMP1	Dentin matrix protein 1	12.4
Jund	Jun D proto-oncogene	2.2
Hoxc10	Homeo box C10	−3.2
Mmp8	Matrix metallopeptidase 8	3.1
Runx2	Runt-related transcription factor 2	6.3
Sox6	Sry-box containing gene 6	3.9
Sp1	Sp1 transcription factor	2.8
Igf2	Insulin-like growth factor 2	3.7
Wnt5a	Wingless-type MMTV integration site family, member 5A	4.7
Zfand5	Zinc finger, AN1-type domain	2.1
Wnt signaling pathway
Apc2	Adenomatous polyposis coli	2.3
Axin2	Axin2	4.3
Ccnd1	Cyclin D1	2.4
Dkk1	Dickkopf1 homolog (Xenopus laevis )	3.4
Dvl1	Disheveled, dsh homologue 1 (Drosophila)	2.2
Fzd1	Frizzled-1	2.6
Fzd6	Frizzled-6	3.2
Lrp5	Low-density lipoprotein receptor-related protein 5	2.8
Nfat5	Nuclear factor of activated T-cells 5	2.4
Ppp3ca	Protein phosphatase 3 (formerly 2B), catalytic subunit, a-isoform	3.1
Tcf3	Transcription factor 3	2.1
Sfr4	Secreted frizzled-related protein 4	2.3
Wnt5a	Wingless-type MMTV integration site family, member 5A	5.7
Wif1	Wnt inhibitory factor 1	−3.1

Abbreviation: GO, gene ontology.

Table 6 Immunohistochemical analysis of positively stained cells in the defects region

	Blank	HA	EMC	IMC	Sham
Wnt5a
–					+++++
7 days	+	+	++	+++
14 days	+	++	+++	++++
β-Catenin
–					+++++
7 days	+	+	++	+++
14 days	+	+	+++	++++
Axin2
–					+++++
7 days	+	+	+++	+++
14 days	+	++	+++	++++

Notes: +, 1–100 cells/mm²; ++, 101–200 cells/mm²; +++, 201–400 cells/mm²; ++++, 401–800 cells/mm²; +++++, >800 cells/mm².

Abbreviations: EMC, extrafibrillar mineralized collagen; HA, nano-hydroxyapatite; IMC, intrafibrillar mineralized collagen.

Figure 5 Immunohistochemical analysis of positively stained cells in the defect regions of different groups.

Notes: (A) At day 7. (B) At day 14. (C) The sham surgery group without primary antibody was used as a NC. Black arrows indicate positively stained cells.

Abbreviations: EMC, extrafibrillar mineralized collagen; HA, nano-hydroxyapatite; IMC, intrafibrillar mineralized collagen; NC, negative control; OB, old bone; S, scaffold materials.

Figure 6 In vitro osteogenic differentiation capacity of rBMSCs on different materials.

Notes: (A) Primary rBMSCs. (B) rBMSCs of passage 3. (C) Flow cytometric analysis of rBMSCs. (D) ALP activity assay after coculture for 7 and 14 days. (E) ARS staining of rBMSCs cultured on HA, EMC, and IMC for 21 days. *P<0.05 vs HA, ^#P<0.05 vs EMC.

Abbreviations: ALP, alkaline phosphatase; ARS, alizarin red S; EMC, extrafibrillar mineralized collagen; HA, nano-hydroxyapatite; IMC, intrafibrillar mineralized collagen; rBMSCs, rat bone marrow-derived mesenchymal stem cells.

Figure 7 qRT-PCR for specific gene expression.

Notes: Fold change in expression of Wnt5a, β-catenin, and Axin2 on different materials after coculture for 3 and 7 days. *P<0.05 vs HA, ^#P<0.05 vs EMC.

Abbreviations: EMC, extrafibrillar mineralized collagen; HA, nano-hydroxyapatite; IMC, intrafibrillar mineralized collagen; qRT-PCR, quantitative real-time transcription polymerase chain reaction.

Figure 8 Evaluation of rBMSCs on IMC scaffolds with the Wnt signaling pathway inhibitor Dkk1.

Notes: (A) ALP activity assay at days 7 and 14. (B) Fold change in expression of Wnt5a, β-catenin, and Axin2 at day 3. *P<0.05 vs IMC.

Abbreviations: ALP, alkaline phosphatase; Dkk1, Dickkopf-1; IMC, intrafibrillar mineralized collagen; rBMSCs, rat bone marrow-derived mesenchymal stem cells.