Porous Se@SiO₂ nanocomposite promotes migration and osteogenic differentiation of rat bone marrow mesenchymal stem cell to accelerate bone fracture healing in a rat model

Figures & data

Table 1 Primers used in RT-PCR

Gene	Forward primer sequence (5′–3′)	Reverse primer sequence (5′–3′)
Runx2	CCTGAACTCAGCACCAAGTCCT	TCAGAGGTGGCAGTGTCATCA
OCN	AATAGACTCCGCGCTACCTC	GCTAGCTCGTCACAATTGGG
SDF-1	CTCTGCATCAGTGACGGTAAGC	GGATTTTCAGATGTTTGACGTTGG
CXCR4	CATCTGTGACCGCCTTTACCC	GACGCTCTCGAACTCACATCC
BMP-2	CCTATATGCTCGACCTGTACCG	CTGGCTGTGGCAGGCTTTAT
Smad-1	AAGCCTCTGGAATGCTGCGA	GCTCATTTTGTCCCAGGTTTCG
GADPH	CAAGTTCAACGGCACAGTCA	CCCCATTTATGTTAGCGGG

Abbreviation: RT-PCR, real-time reverse transcription polymerase chain reaction.

Figure 1 The characterization and cytotoxicity of the Se@SiO₂ nanocomposites. (A) XRD pattern of the solid Se@SiO₂ nanocomposites and the standard hexagonal phase of Se (JCPDS card no: 65-1876). (B) Low- and (C) high-magnification TEM image of the solid Se@SiO₂ nanocomposites. (D) Medium-magnification images of the porous Se@SiO₂ nanocomposites. (E) The cell viability of BMSCs treated with different concentrations of the porous Se@SiO₂ nanocomposites for 24 hrs. Data are expressed as means ± SDs (n=3). (F) The cumulative release kinetics of Se from the porous Se@SiO₂ nanocomposites in PBS at 37°C and pH 7.4.

Abbreviations: TEM, transmission electron microscopy; XRD, X-ray diffractometer.

Figure 2 Porous Se@SiO₂ nanocomposite has a powerful capacity to promote BMSCs migration. (A and B) The porous Se@SiO₂ nanocomposite can promote migration of BMSCs, which was demonstrated by transwell assays. BMSCs that passed through the membrane were detected with crystal violet staining. (C) The gene expression of SDF-1 in the blank group and Se@SiO₂ group was compared using RT-PCR. ***p<0.05, blank group vs Se@SiO₂ group. Data are expressed as means ± SDs (n=3). (D) The gene expression of CXCR4 in the blank group and Se@SiO₂ group. **p<0.05, blank group vs Se@SiO₂ group. All data were expressed as mean ± SDs (n=3).

Abbreviation: BMSCs, bone marrow mesenchymal stem cells.

Figure 3 Porous Se@SiO₂ nanocomposite can reduce intracellular ROS formation and protect BMSCs against hydrogen peroxide-induced apoptosis. (A–D) The production of ROS induced by H₂O₂ in the H₂O₂ group was higher than that in the H₂O₂+ Se@SiO₂ group, and the porous Se@SiO₂ nanocomposite at a concentration of 160 µg/mL could decrease the level of intracellular ROS more than porous Se@SiO₂ nanocomposite at a concentration of 80 µg/mL. (E–H) Cell apoptosis was detected by flow cytometry analysis after staining with Annexin V and PI. (I–T) Staining BMSCs with DAPI and TUNEL. (U) Staining of BMSCs with ROS and DAPI, ***p<0.05, blank group vs H₂O₂ group, **p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group (80 μg/mL), **p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group (160 μg/mL). Data are expressed as means ± SDs (n=3). (V) The bar graph of early apoptosis rate (%), ***p<0.05, blank group vs H₂O₂ group, **p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group (80 μg/mL), ***p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group (160 μg/mL). Data are expressed as means ± SDs (n=3). (W) The bar graph of late apoptosis rate (%), *p<0.05, blank group vs H₂O₂ group, **p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group (80 μg/mL), **p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group (160 μg/mL). Data are expressed as means ± SDs (n=3). (X) Statistical analysis of TUNEL staining. The numbers of TUNEL-positive cells of all cells was calculated under a fluorescent microscope. ***p<0.05, blank group vs H₂O₂ group, *p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group (80 μg/mL), ***p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group (160 μg/mL). All data are expressed as means ± SDs (n=3).

Abbreviations: ROS, reactive oxygen species; DCF, dichlorofluorescein; DAPI, 4',6-diamidino-2-phenylindole; FITC, fluorescein isothiocyanate; PI, propidium iodide.

Figure 4 Porous Se@SiO₂ nanocomposite can promote osteogenic differentiation of BMSCs and protect BMSCs against H₂O₂-induced inhibition of osteogenic differentiation through the BMP/Smad signaling pathway. (A–H) The ALP activity of each group was measured after 7 days. (I–P) Calcium deposits of each group were measured by Alizarin Red staining after 21 days. (Q–T) After 7 days of osteogenic induction, the genes of each group related to osteogenic differentiation of BMSCs were analyzed by RT-PCR. (Q) Porous Se@SiO₂ nanocomposite increased the expression of Runx2. ***p<0.05, blank group vs Se@SiO₂ group, **p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group. (R) Porous Se@SiO₂ nanocomposite increased the expression of OCN. ***p<0.05, blank group vs Se@SiO₂ group, ***p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group. (S) Porous Se@SiO₂ nanocomposite increased the expression of BMP-2. **p<0.05, blank group vs Se@SiO₂ group, *p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group. (T) Porous Se@SiO₂ nanocomposite increased the expression of Smad1. ***p<0.05, blank group vs Se@SiO₂ group, *p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group. (U and V) Total proteins from four groups were extracted, and we analyzed the levels of Smad1/5/9 and pSmad1/5/9 by Western blot. β-Actin was used as a loading control. (W) Expression of Smad1/5/9 was determined by Western blotting. There was no significant difference of blank group vs Se@SiO₂ group and H₂O₂ group vs H₂O₂+ Se@SiO₂ group, ^#p>0.05. (X) Expression of pSmad1/5/9 was determined by Western blotting. **p<0.05, blank group vs Se@SiO₂ group, **p<0.05, H₂O₂ group vs H₂O₂+ Se@SiO₂ group. All data are expressed as means ± SDs (n=3).

Abbreviations: ALP, alkaline phosphatase; ARS, Alizarin Red s.

Figure 5 Porous Se@SiO₂ nanocomposite promoted the translocation of pSmad1/5/9 from the cytoplasm to the nucleus. (A–X) Immunofluorescence analysis of pSmad1/5/9 in four different groups.

Abbreviation: DAPI, 4',6-diamidino-2-phenylindole.

Figure 6 Radiographs at 2, 4 and 6 weeks were taken after the operation. (A–F) The bridging callus formation was observed at 2 weeks after operation in the Se@SiO₂ group. The cortical gap of the Se@SiO₂ group disappeared at 4 weeks postoperatively. On the other hand, bridging callus formation in the blank group was observed at 4 weeks, and there was no bone union at 4 weeks. All data are expressed as means ± SDs (n=3).

Figure 7 The results of micro-CT of fracture callus at 6 weeks after operation. (A–F) Representative images of micro-CT of the Se@SiO₂ group and blank group. (G) The BMD was analyzed by micro-CT. *p<0.05, blank group vs Se@SiO₂ group. (H) The BV/TV was analyzed by micro-CT. *p<0.05, blank group vs Se@SiO₂ group.

Abbreviations: CT, computed tomography; BMD, bone mineral density; BV, bone volume; TV, tissue volume.

Figure 8 Mechanism of porous Se@SiO₂ nanocomposites to promote osteogenic differentiation of BMSCs and protect BMSCs against H₂O₂-induced inhibition of osteogenic differentiation.