Selenium Nanoparticles Pre-Treatment Reverse Behavioral, Oxidative Damage, Neuronal Loss and Neurochemical Alterations in Pentylenetetrazole-Induced Epileptic Seizures in Mice

Figures & data

Figure 1 The histogram of size distribution measured by a Malvern Zetasizer.

Table 1 Primer Sequences of Genes Analyzed in Real-Time PCR

Name	Accession Number	Forward Primer (5ʹ—3ʹ)	Reverse Primer (5ʹ—3ʹ)
GAPDH	NM_017008.4	AGTGCCAGCCTCGTCTCATA	GATGGTGATGGGTTTCCCGT
SOD2	NM_017051.2	TAAGGGTGGTGGAGAACCCA	TGATGACAGTGACAGCGTCC
CAT	NM_012520.2	TTTTCACCGACGAGATGGCA	AAGGTGTGTGAGCCATAGCC
GPx1	NM_030826.4	CAGTCCACCGTGTATGCCTT	GTAAAGAGCGGGTGAGCCTT
GR	NM_053906.2	TACTGCACTTCCCGGTAGGA	TGGATGCCAACCACCTTCTC

Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SOD2, superoxide dismutase 2 mitochondrial (MnSOD); CAT, catalase; GPx1, glutathione peroxidase 1; GR, glutathione reductase.

Table 2 The Effect of Selenium Nanoparticles (SeNPs) on Behavioral Alterations Induced Following Pentylenetetrazole (PTZ) Injection in Mice

Groups	Duration of Seizure (sec.)				Mortality%
	Onset	Myoclonic	Tonic	Tonic-Clonic
Cont	—	—	—	—	—
SeNPs	—	—	—	—	—
PTZ	12±3^#	15±5^#	13±23^#	98±43^#	85^#
SeNPs + PTZ	36±7^#$	6±2^#$	5±3^#$	43±11^#$	0^$

Notes: Results are presented as mean ± SD (n = 10); significant change was recorded following analysis with Mann Whitney U and Student’s t-tests at P < 0.05. ^#Represents a significant change against the control mice; ^$Represents a significant change against the PTZ-injected mice.

Figure 2 Effect of selenium nanoparticles (SeNPs) on pro-oxidants level [malondialdehyde (MDA) and nitric oxide (NO)], heat shock protein 70 (Hsp70), glutathione (GSH) level in the hippocampal tissue following pentylenetetrazole (PTZ) injection. Results are figured as mean ± SD (n = 10); significant change was recorded following analysis with Duncan’s test as a post hoc test (P < 0.05). ^#Represents a significant change against the control mice; ^$Represents a significant change against the PTZ-injected mice.

Figure 3 Effect of selenium nanoparticles (SeNPs) on mRNA and activity of antioxidant enzymes [glutathione peroxidase (GPx, Gpx1), glutathione reductase (GR, Gsr), superoxide dismutase (SOD, Sod2) and catalase (CAT, Cat)] in the hippocampal tissue following pentylenetetrazole (PTZ) injection. Biochemical results are figured as mean ± SD (n = 10); significant change was recorded following analysis with Duncan’s test as a post hoc test (P < 0.05). ^#Represents a significant change against the control mice; ^$Represents a significant change against the PTZ-injected mice. qRT-PCR results are presented as mean ± SD of triplicate assays.

Figure 4 Effect of selenium nanoparticles (SeNPs) on the protein expression of nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) in the hippocampal tissue following pentylenetetrazole (PTZ) injection. ^#Represents a significant change against the control mice; ^$Represents a significant change against the PTZ-injected mice.

Figure 5 Effect of selenium nanoparticles (SeNPs) on inflammatory markers TNF-α and IL-1β in the hippocampal tissue following pentylenetetrazole (PTZ) injection. Results are figured as mean ± SD (n = 10); significant change was recorded following analysis with Duncan’s test as a post hoc test (P < 0.05). ^#Represents a significant change against the control mice; ^$Represents a significant change against the PTZ-injected mice.

Figure 6 Effect of selenium nanoparticles (SeNPs) on apoptotic markers Bax, caspase-3 and Bcl2 in the hippocampal tissue following pentylenetetrazole (PTZ) injection. Results are figured as mean ± SD (n = 10); significant change was recorded following analysis with Duncan’s test as a post hoc test (P < 0.05). ^#Represents a significant change against the control mice; ^$Represents a significant change against the PTZ-injected mice.

Figure 7 Effect of selenium nanoparticles (SeNPs) on dopamine (DA), norepinephrine (NE) and serotonin (5-HT) in the hippocampal tissue following pentylenetetrazole (PTZ) injection. Results are figured as mean ± SD (n = 10); significant change was recorded following analysis with Duncan’s test as a post hoc test (P < 0.05). ^#Represents a significant change against the control mice; ^$Represents a significant change against the PTZ-injected mice.

Figure 8 Effect of selenium nanoparticles (SeNPs) on acetylcholinesterase activity (AChE), GABA and glutamate levels in the hippocampal tissue following pentylenetetrazole (PTZ) injection. Results are figured as mean ± SD (n = 10); significant change was recorded following analysis with Duncan’s test as a post hoc test (P < 0.05). ^#Represents a significant change against the control mice; ^$Represents a significant change against the PTZ-injected mice.

Figure 9 Effect of selenium nanoparticles (SeNPs) on hippocampal histological deformations following pentylenetetrazole (PTZ) injection. Scale bar = 100 μm. (A) Control group, (B) SeNPs group, (C) PTZ-injected group, (D) Co-treated group with SeNPs and PTZ, and (E) Co-treated group with sodium valproate (VPA) and PTZ. Degenerated neuron (white arrow). Scale bar = 80 μm.

Figure 10 Schematic diagram shows the protective role of selenium nanoparticles (SeNPs) against epileptic model induced by pentylenetetrazole (PTZ).