Concentration- and time-dependent response of human gingival fibroblasts to fibroblast growth factor 2 immobilized on titanium dental implants

Figures & data

Table 1 Target cDNA primer sequences used in quantitative polymerase chain reaction

VEGFA

Forward: 5′-GAGCCTTGCCTTGCTGCTCTAC-3′

Reverse: 5′-CACCAGGTCTCGATTGGATG-3′

PCR product size: 148 bp

ITGB

Forward: 5′-TGTGTCAGACCTGCCTTGGTG-3′

Reverse: 5′-AGGAACATTCCTGTGTGCATGTG-3′

PCR product size: 105 bp

ICAM1

Forward: TGAGCAATGTGCAAGAAGATAGC

Reverse: CCCGTTCTGGAGTCCAGTACA

PCR product size: 105 bp

LAMA1

Forward: TGGTAACATTTGCCACCACGA

Reverse: TTGCCTCCGATCAGCATGAC

PCR product size: 127 bp

GAPDH (housekeeping gene)

Forward: 5′-GCACCGTCAAGGCTGAGAAC-3′

Reverse: 5′-TGGTGAAGACGCCAGTGGA-3′

PCR product size: 138 bp

Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; ICAM1, intercellular adhesion molecule 1; ITGB, β-integrin; LAMA1, laminin-1; VEGFA, vascular endothelial growth factor A.

Table 2 Measurement of surface roughness by atomic force microscopy

Group	Ra	RMS
PT	32.60 ± 3.45 nm	41.70 ± 3.96 nm
NT	4.96 ± 0.50 nm*	6.23 ± 0.80 nm*
NT-F-L	7.25 ± 0.97 nm*	9.14 ± 1.25 nm*
NT-F-M	9.70 ± 1.85 nm*	11.80 ± 2.21 nm*
NT-F-H	9.42 ± 1.99 nm*	11.79 ± 2.35 nm*

Notes:

* Lower R_a and RMS compared with PT (P < 0.01). Anodization significantly smoothed titanium surface, whereas surface roughness was barely affected by FGF2 immobilization.

Abbreviations: FGF2, fibroblast growth factor 2; NT, nanotube; PT, polished titanium; R_a, average roughness, RMS, root mean square roughness.

Figure 1 Immobilized FGF2 compared with FGF2-free samples initially and after 9 days.

Abbreviations: FGF2, fibroblast growth factor 2; NT, nanotube; PT, polished titanium.

Figure 2 Field emission scanning electron microscopy results. (A) NT surface showed an NT array structure; NT-F-H surface showed clumps of fibroblast growth factor 2 and that the typical NT surface was changed. (B) Profile of titania NT.

Note: The length of NT was 588.85 ± 31.92 nm (mean value ± standard deviation).

Abbreviations: NT, nanotube; PT, polished titanium.

Figure 3 Atomic force microscopy images of different surfaces: (A) PT, (B) NT, (C) NT-F-L, (D) NT-F-M, and (E) NT-F-H. PT showed a microgroove structure, and porous-like structures were observed in other groups.

Abbreviations: NT, nanotube; PT, polished titanium.

Table 3 Elution of dissolvable FGF2 at different time intervals*

Time interval	NT-F-L		NT-F-M		NT-F-H
	Mass (ng)	Percent (accumulative)	Mass (ng)	Percent (accumulative)	Mass (ng)	Percent (accumulative)
D0~D1	10	36.76	24	36.70	35.6	41.59
D1~D2	6	58.82	14.1	58.26	16.5	60.86
D2~D3	3	69.85	7.9	70.34	8.9	71.26
D3~D6	4.5	86.40	11.5	87.92	15.5	89.37
D6~D9	1.5	91.91	4.5	94.80	5.7	96.03
D9~D15	1.4	97.06	2.3	98.32	2.1	98.48
D15~D21	0.6	99.26	0.7	99.39	0.8	99.42
D21~D30	0.2	100.00	0.4	100.00	0.5	100.00

Notes:

* Average amounts and accumulative percent of eluted FGF2 at each time interval. FGF2 rapidly eluted within the first 3 days, followed by a gradual reduction in elution. Over 90% of the dissolvable immobilized FGF2 eluted within 9 days. After 21 days, additional elution was negligible.

Abbreviations: FGF2, fibroblast growth factor 2; NT, nanotube; PT, polished titanium.

Figure 4 Elution kinetics of various FGF2 immobilizations. FGF2 eluted rapidly within first 3 days and the elution velocity reduced with time. Approximately all dissolvable FGF2 eluted within 30 days.

Abbreviations: FGF2, fibroblast growth factor 2; NT, nanotube.

Figure 5 HGF adhesion. (A) HGFs attached to the substrates with 4′,6′-diamidino-2-phenylindole stain and (B) relative cell adhesion rate of attached HGFs. The NT and NT-F-H surfaces inhibited cell adhesion, whereas the NT-F-L and NT-F-M improved cell attachment.

Notes: ^#Higher than PT (P < 0.01), *lower than PT (P < 0.01), difference also exists between 1*, 2*, 1^#, and 2^# (P < 0.01).

Abbreviations: HGF, human gingival fibroblast; NT, nanotube; PT, polished titanium.

Figure 6 Cell proliferation measured by the methyl-thiazolyl-tetrazolium assay. NT-F-L and NT-F-M showed the higher cell proliferation at each interval, whereas NT-F-H with overimmobilized FGF2 showed the lowest at the early stage (Days 1 and 3).

Notes: ^#Higher than PT (P < 0.01), *lower than PT (P < 0.01), significant difference exists between 1^# and 2^# (P < 0.01).

Abbreviations: FGF2, fibroblast growth factor 2; NT, nanotube; OD, optical density; PT, polished titanium.

Figure 7 Morphology of HGFs: (A) PT, (B) NT, (C) NT-F-L, (D) NT-F-M, and (E) NT-F-H lacking sufficient prominences/pseudopods and not fusing together.

Abbreviations: HGF, human gingival fibroblast; NT, nanotube; PT, polished titanium.

Table 4 Summary of extracellular matrix-related gene expressions on Days 3, 6, and 9

	VEGFA			ITGB			ICAM1			LAMA1
	D3	D6	D9	D3	D6	D9	D3	D6	D9	D3	D6	D9
NT	+	+	+	+	+	+	/	/	/	+	+2	/
NT-F-L	+2	+2	+2	+3	+2	+2	/	/	/	+2	+3	+
NT-F-M	+3	+2	+4	+4	+4	+2	+	+	+	+2	+3	+
NT-F-H	+4	+3	+3	+2	+3	+2	−	+2	+	−	+	+

Notes: +, Upregulated compared with PT (P < 0.01); −, downregulated (P < 0.01);/, no significant difference compared with PT.

Abbreviations: ICAM1, intercellular adhesion molecule 1; ITGB, β-integrin; LAMA1, laminin-1; NT, nanotube; PT, polished titanium; VEGFA, vascular endothelial growth factor A.

Figure 8 Extracellular matrix-related gene expressions by HGFs cultured on four different titanium surfaces at Days 3, 6, and 9: (A) VEGFA, (B) ITGB, (C) ICAM1, and (D) LAMA1. Inverse concentration-dependent effects of NT-F-H were observed at Day 3 on (C) and (D).

Notes: ^#Upregulated compared with PT (P < 0.01), *downregulated (P < 0.01), significant difference exists between 1*, 2*, 1^#, and 2^# (P < 0.01).

Abbreviations: HGF, human gingival fibroblast; ICAM1, intercellular adhesion molecule 1; ITGB, β-integrin; LAMA1, laminin-1; NT, nanotube; PT, polished titanium; VEGFA, vascular endothelial growth factor A.

Figure 9 Activity changes of dissolvable FGF2 (10 ng/mL): control (FGF2-free); newly prepared Dulbecco’s modified Eagle’s medium; and S1, S3, S6, and S9 (FGF2 in Dulbecco’s modified Eagle’s medium stored for 1 day, 3 days, 6 days, or 9 days, respectively). The activity of FGF2 reduced gradually in culture medium with time and dropped to less than 50% after 9 days (S9) compared with NP.

Note: ^#Higher than PT (P < 0.01), significant difference exists between 1^#, 2^#, and 3^# (P < 0.01).

Abbreviations: FGF2, fibroblast growth factor 2; NT, nanotube; OD, optical density; PT, polished titanium.

Figure 10 Pattern of nanotube-based FGF2 control release system: (A) initial stage, (B) in culture medium, FGF2 is gradually released from the nanotubes.

Abbreviation: FGF2, fibroblast growth factor 2.