Potential Privilege of Maltodextrin-α-Tocopherol Nano-Micelles in Seizing Tacrolimus Renal Toxicity, Managing Rheumatoid Arthritis and Accelerating Bone Regeneration

Figures & data

Figure 1 (A) Determination of CMC by DLS: A comparative plot of intensity of scattered light (left axis, ★) and hydrodynamic diameter (right axis, ■) as a function different polymer concentrations (B) Schematic presentation for the preparation of TAC loaded polymeric micelles (C) TEM micrograph showing morphology of A10 and B10 with core–shell structure and (D) particle size distribution diagram of A10 and B10.

Table 1 Primers Sequences Used for qRT-PCR in AIA Study

Target	Sequence	Accession Number
Osteocalcin	AAG GTG GTG AAT AGA CTC CG (Forward)	NM_013414.1
	AAA CGG TGG TGC CAT AGA TG (Reverse)
Osteopontin	CTC AGA GGA GAA GGC GCA TTG (Forward)	NM_012881.2
	TCT CTG CAT GGT CTC CGT CGT (Reverse)
SOX9	AGGAAGCTGGCAGACCAGTA (Forward)	NM_080403.1
	CGAAGGGTCTCTTCTCGCT (Reverse)
GAPDH	TGCCACTCAGAAGACTGTGG (Forward)	NM_ 017008.4
	TTCAGCTCTGGGATGACCTT (Reverse)

Table 2 Physico-Chemical Characterization of Maltodextrin-A-Tocopherol Conjugates

#	Composition Ratio Of Conjugate (MD Repeating Units: α-TOC)	Molecular Weight (^1H-NMR) (Da)	DD% (^1H-NMR)	CMC (mg/mL)
A	10:2	5566.989	7.90	6.08×10^−4
B	10:3	5902.481	10.28	4.15×10^−4

Figure 2 Solid state characterization (A) DSC thermograms of TAC, A10 and B10. (B) FT-IR spectra of TAC, A10, B10, maltodextrin-α-tocopherol (10:2) and maltodextrin-α-tocopherol (10:3).

Table 3 Effect of DD Value, Polymeric Composition Ratio of Maltodextrin-α-Tocopherol Nano-micelles and TAC Ratios on the Following: Particle Size, Zeta Potential, PDI, and EE%

#	Polymer	Polymer: Drug (wt:wt)	Particle Size (d.nm)	Zeta Potential (mv)	PDI	EE (w/w) %	DL (w/w) %
A1	10:2	1:1	194.5±12.75	−13.21±1.3	0.518±0.065	31.47%±2.97	15.73%±1.39
B1	10:3	1:1	144.4±7.60	−11.2±2.32	0.675±0.024	34.51%±3.91	17.25%±0.73
A5	10:2	5:1	134.1±2.42	−19.9±2.43	0.218±0.008	47.46%±8.26	7.91%±0.91
B5	10:3	5:1	97.7±7.16	−16.2±3.95	0.379±0.028	53.93%±5.33	8.98%±0.36
A10	10:2	10:1	74.78±0.14	−22.5±6.05	0.122±0.004	94.85%±4.95	8.55%±0.12
B10	10:3	10:1	43.53±0.33	−20.3±6.66	0.287±0.004	97.95%±8.37	8.90%±0.87
A20	10:2	20:1	68.03±0.94	−24.6±2.15	0.298±0.016	95.01%±5.19	8.71%±0.17
B20	10:3	20:1	39.08±0.24	−22.1±8.46	0.225±0.003	96.43%±3.52	8.78%±0.21

Figure 3 (A) In vitro drug release of TAC from A10, B10 and its ethanolic solution in PBS (pH 7.5, pH 6.5 and pH 5.5) at 100 rpm and 37°C using the dialysis bag method. Physical stability of A10 and B10 micelles stored at 4°C over 3 months expressed as (B) change in particle size, PDI, (C) zeta potential and EE% with time. (D) Serum stability of A10 and B10 in 10% fetal bovine serum (FBS) solution. Physical stability of A10 and B10 micelles at dilution factors (10, 50, and 100) expressed as change in (E) particle size and (F) PDI.

Figure 4 In vitro toxicological assessment (I): Hemolytic activity test of A10 and B10 expressed as (A) % hemolysis (mean±SD) and (B) optical microscopic images of RBCs at the end of hemolysis test. Cytotoxicity test by MTT assay of prepared A10 and B10 on (C) Vero kidney cell line and on (D) PBMCs cell line after 48h of incubation [* P≤ 0.05 vs TAC, mean ± SD].

Figure 5 In vivo toxicological assessment (II): (A) Kaplan-Meier survival curve for the overall survival of rats during sub-acute toxicity study. (B) Mean body weight (mean ± SEM) [* significantly increase vs 0-time, ** significantly decrease vs 0-time, P≤ 0.05]. (C) Photomicrographs of H and E stained kidney sections of rats treated with TAC, A10, and B10 showing renal cortex of renal corpuscle (RC), proximal (PT) and distal (DT) tubules and liver sections showing central vein (CV), radiated hepatic cords (*) and hepatic sinusoids (arrows) (original magnifications ×400) and (D) kidney (Bowman space area) and liver (sinusoids area) histological scores of TAC, A10, and B10 treated groups [* P≤ 0.05 vs TAC, mean ± SD].

Figure 6 Assessment of AIA model (I): (A) Experimental timeline of the AIA model used showing induction and treatment protocols. (B) Mean body weights (mean ± SEM) during induction and treatment period [** significantly increase vs 14 days reading, * significantly decrease vs 0-time, P≤ 0.05]. (C) Images of hind paws of different treated groups at 0, 14- and 28-days post-induction (NC= negative control and PC= positive control), [red circle= severe inflammation, blue circle= mild inflammation, yellow circle= no inflammation].

Table 4 Effect of Acute IV Administration of Free TAC, A10, B10 on Hematological Parameters in Rats

	Control (Saline)		Treatment Groups
	Zero Time	After 14 Days	TAC		A10		B10
			Zero Time	After 14 Days	Zero Time	After 14 Days	Zero Time	After 14 Days
			Hematological parameters
HGB (mg/dL)	14.08±0.5	14.5±0.5	14.1±0.1	15.4±0.6	12.9±0.4	14.3±0.8	15.5±0.8	14.7±0.6
HCT (%)	43.8±1.5	47.9±1.6 ^a	42.5±0.3	50.7±1.4^a	47±1.9	48.3±1.4	47.2±0.9	46.4±0.7
RBC (×10^6 µL)	8.64±0.05	8.75±0.05	7.64±0.2	8.43±0.1	7.58±0.4	8.63±0.3	9.18±0.1	8.57±0.3
WBC (×10^3 µL)	19.6±0.2	19.7±0.2	18.7±0.2	19.1±0.6	18.7±1.1	21.6±1.5	17.5±1.7	18.7±1.6
Neutrophils (%)	12.8±0.4	12.5±0.5	11.6±0.4	10.7±0.6	13.4±0.2	13±0.4	13.6±0.5	14.2±0.3
Lymphocytes (%)	82.3±0.8	83.5±0.8	82.3±1.2	82.3±0.8	82.5±0.9	82.1±0.8	80.3±1.2	81.6±3.9
Monocytes (%)	1.5±0.15	1.2±0.21	1.8±0.2	1.6±0.2	1.8±0.2	1.6±0.2	1.9±0.4	1.9±0.4
Eosinophils (%)	1.8±0.2	1.3±0.1^a	2.2±0.1	2.5±0.6	2±0.07	1.8±0.1	1.8±0.1	1.7±0.07
Basophils (%)	1.8±0.2	1.5±0.1	2.8±0.4	2.8±0.7	1.8±0.2	1.9±0.2	1.7±0.1	1.6±0.1
RDW (%)	17.3±0.4	17.9±0.3^a	13.6 ±0.7	15.5±1.1	16.4±0.4	17±0.8	18.2±0.9	19.4±0.5
MCV (fL)	50.5±1.4	54.7±1.4^a	56.4±0.5	60.3±2.7	56.7±3	54.6±1.2	51.6±2	55.2±2.7
MCH (pg)	16.2±0.3	16.5±0.2	18.6±0.2	18.1±0.3	17.5±0.4	16.1±0.7^a	16.8±0.3	16.7±0.4
MCHC (mg/dL)	32.1±1.5	30.2±0.8	33±0.5	30.3±0.7^a	32.8±1.05	29.4±1.1	32.8±0.6	30.9±1.1
PLT (×10^3 µL)	1206±9.6	1153±13.6^a	969±7.8	1055±37.3	976±6.2	1167±34.3	1079±15.1	1027±19.5

Notes: Values are given as mean (± S.E.M. n = 5). ^a: indicates significant difference with the same group at zero time.

Table 5 Effect of Acute IV Administration of Free TAC, A10, B10 on Biochemical Parameters in Rats

	Control (Saline)		Treatment Groups
	Zero Time	After 14 Days	TAC		A10		B10
			Zero Time	After 14 Days	Zero Time	After 14 Days	Zero Time	After 14 Days
Biochemical parameters
Urea (mg/dL)	47.3±2.4	46.3±2.2	44.1±1.9	48.3±1.9^a	38.7±1.6	40.9±2.1	43.8±3.1	40.5±2.1
Creatinine (mg/dL)	0.49±0.02	0.51±0.02	0.51±0.06	0.94±0.1^a	0.46±0.04	0.48±0.03	0.44±0.03	0.43±0.05
AST (IU/L)	97.5±3.8	111±5.9	106±9.5	769±39 ^a	156±19.4	124±20.7	144±15.1	145±14.4
ALT (IU/L)	67.1±2.4	66.9±2.7	68.5±2.1	72.3±3.9	80.5±3.5	82.3±3.6	88.2±5.5	84.5±3.7

Notes: Values are given as mean (± S.E.M. n = 5). ^aindicates significant difference with the same group at zero time.

Figure 7 Assessment of AIA model (II): (A) Clinical arthritis score (mean ± SEM) [* significantly decreased after treatment, P≤ 0.05] and (B) paw thickness (mean ± SEM) [* significantly decreased after treatment, P≤ 0.05].

Abbreviations: NC, negative control; PC, positive control.

Figure 8 Concentration of pro-inflammatory cytokines. (A) Serum level of IL-6, (B) synovial fluid level of IL-6, (C) serum level of TNF-a, and (D) synovial fluid level of TNF-a [* P≤ 0.05 vs PC, ** P≤ 0.05 vs PC and TAC groups, mean± SEM, n = 5].

Abbreviations: NC, negative control; PC, positive control.

Figure 9 Concentration of bone and cartilage formation proteins: Level of osteocalcin protein in (A) serum, (B) synovial fluid and (C) its mRNA expression. Level of osteopontin protein in (D) serum, (E) synovial fluid and (F) its mRNA expression. level of SOX9 chondrogenic protein in (G) serum, (H) synovial fluid and (I) mRNA expression of SOX9 chondrogenic protein. [* P≤ 0.05 vs PC, ** P≤ 0.05 vs PC and TAC groups, mean± SEM, n = 5].

Abbreviations: NC, negative control; PC, positive control.

Figure 10 Histopathologic evaluation of AIA model paws. (A) H&E staining, ×200. (NC) Negative control group showing normal tissue, (PC) positive control group showing intense inflammatory infiltrate (blue arrow), extensive pannus formation (red arrow) and intense bone erosion (yellow arrow), (TAC susp.) group with moderate inflammatory infiltrate, moderate pannus formation (red arrow) and mild bone erosions (yellow arrow), (A10) group with moderate inflammatory infiltrate (blue arrow), no pannus, normal cartilage, and bone, (A10 blank) group showing moderate inflammatory infiltrate (blue arrow) with mild pannus formation (red arrow), (B10) group with mild inflammatory infiltrate (blue arrow), no pannus, normal cartilage, and bone, (B10) blank group showing severe inflammatory infiltrate (blue arrow) with mild pannus formation (red arrow). (B) Alcian blue staining, ×200. (NC) with normal bone and cartilage (blue color, black arrow), (PC) with intense cartilage and bone erosion (black arrows), (Tac susp.)with mild cartilage erosion (black arrow), (A10) with normal cartilage and bone (blue color, black arrow), (A10 blank) with mild cartilage erosion and normal bone (black arrow), (B10) with normal cartilage and bone (blue color, black arrow), (B10 blank) with mild cartilage erosion and normal bone (black arrow). (C) Histological scores of synovial inflammations, pannus formation, cartilage and bone erosion. [* P≤ 0.05 vs TAC groups, mean± SEM, n = 5].