The effect of aspirin nanoemulsion on TNFα and iNOS in gastric tissue in comparison with conventional aspirin

Figures & data

Figure 1 Photographs of aspirin-containing nanoemulsions of the present study by transmission electron microscopy.

Notes: (A) Shows the size of one of the obtained nanoparticles which equals 155nm. (B) Shows an obtained nanoparticle with sphere shape and 200 nm diameter. (C) Shows a nanoparticle which is 181.5 nm. (D and E) Shows dispersed aspirin nanoparticles with a sphere shape.

Table 1 Primers of the tested parameters

	Forward primer	Reverse primer
β-actin	GGCCAACCGTGAAAAGATGA	CAGCCTGGATGGCTACGTACA
TNFα	CGTCGTAGCAAACCACCAAG	ACACAGAGCAATGACTCCAAAG
iNOS	CGGTTCACAGTCTTGGTGAAAG	CAGGTGTTCCCCAGGTAGGTAG

Figure 2 Effect of negative control, aspirin, blank nanoemulsion, and aspirin nanoemulsion on TNFα level in gastric tissue.

Notes: *Significant compared to control; ^#significant compared to aspirin (group 3).

Abbreviation: SD, standard deviation.

Figure 3 Effect of negative control, blank nanoemulsion, aspirin, and aspirin nanoemulsion on iNOS level in gastric tissue.

Notes: *Significant compared to control; ^#significant compared to aspirin (group 3).

Abbreviation: SD, standard deviation.

Figure 4 Effect of negative control, blank nanoemulsion, aspirin, and aspirin nanoemulsion on PGE-2 level in gastric tissue.

Notes: *Significant compared to control; ^#significant compared to aspirin (group 3).

Abbreviations: SD, standard deviation; PGE-2, prostaglandin E₂.

Table 2 Levels of GSH, GR, and GPx in gastric tissue in different groups

Groups	Mean ± SD of GSH (mmol/g)	Mean ± SD of GR (U/g)	Mean ± SD of GPx (U/g)
Group 1 (control)	47.8±6	313±19.6	131.4±15.3
Group 2 (blank nanoemulsion)	43.5±5.3	300.1±14.6	122.9±7.4
Group 3 (aspirin)	32.9±3.6*	131.2±16.8*	76.2±5.3*
Group 4 (aspirin nanoemulsion)	45.7±3.5#	310.4±37#	131.2±15.4#

Notes:

* Significant variation at P<0.05 compared to the control group, blank nanoemulsion group and aspirin nanoemulsion group.

# Significant variation at P<0.05 compared with the aspirin group but there was no significant difference compared to both control and blank nanemulsion groups..

Abbreviations: GSH, glutathione; GR, glutathione reductase; GPx, glutathione peroxidase; SD, standard deviation.

Table 3 Levels of catalase, SOD, and MDA in gastric tissue in different groups

Groups	Mean ± SD of catalase (U/g)	Mean ± SD of SOD (U/g)	Mean ± SD of MDA (nmol/g)
Group 1 (control)	2.3±0.3	72.1±9.7	38.5±3.7
Group 2 (blank nanoemulsion)	2.3±0.4	69.8±3.5	42.5±3.4
Group 3 (aspirin)	1.3±0.5*	43.8±5.7*	49.6±7.8*
Group 4 (aspirin nanoemulsion)	2.1±0.3#	55.3±5.8*,#	39.01±4.6#

Note:

*,# Significant variation at P<0.05.

Abbreviations: SOD, superoxide dismutase; MDA, malondialdehyde; SD, standard deviation.

Figure 5 Photomicrographs.

Notes: (A, B) Stomachs of the control group (group 1) and blank nanoemulsion-treated group (group 2), showing normal stomach architecture (H&E, 200×); (C, D) stomachs of the aspirin-treated group (group 3), showing massive sloughing of the superficial parts of gastric glands (arrows) (H&E, 200×). (D) shows more damaged epithelium than in (C) and the sloughing tissue occurs at a larger area. (E, F) stomachs of the aspirin nanoemulsion-treated group (group 4), showing normal gastric gland architecture (H&E, 200×). (F) Shows more healthy and intact gastric epithelium with no inflammatory cells infiltration than in (E).

Abbreviation: H&E, hematoxylin and eosin.