The umbilical cord, preeclampsia and the VEGF family

Figures & data

Table 1 Primers of PLGF, sFLT1, VEGF and 18S genes

Gene	Direction	Primer sequence (5′–3′)	Fragments size
PLGF	Forward	GTTCAGCCCATCCTGTGTCT	163 bp
	Reverse	AACGTGCTGAGAGAACGTCA
sFLT1	Forward	GGCTGTTTTCTCTCGGATCTC	158 bp
	Reverse	CATCTCCTCCGAGCCTGAAAG
VEGF	Forward	GTC CCT CTT GGA ATT GGAT	114 bp
	Reverse	TGTATGTGGGTGGGTGTGTC
18S	Forward	ACGGACCAGAGCGAAAGCAT	145 bp
	Reverse	GCGGGTCATGGGAATAACG

Table 2 VEGF family and demographic features

Variable	Total patients (N=40), n (%)	Patients by study group, n (%)
		PE	PE and UCAA	UCAA	Normal
Newborn gender
Male	20 (50)	6 (15)	5 (12.5)	4 (10)	5 (12.5)
Female	20 (50)	4 (10)	5 (12.5)	6 (15)	5 (12.5)
Twins
Twin pregnancy	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)
Singleton pregnancy	40 (100)	10 (25)	10 (25)	10 (25)	10 (25)
Parity
3 or more children	9 (22.5)	0 (0)	5 (12.5)	1 (2.5)	3 (7.5)
2 children	15 (37.5)	2 (5)	3 (7.5)	5 (12.5)	5 (12.5)
1 child	16 (40)	8 (20)	2 (5)	4 (10)	2 (5)
Gestational age (weeks)
Preterm <37	15 (37.5)	7 (17.5)	8 (20)	0 (0)	0 (0)
Term 37–40	25 (62.5)	3 (7.5)	2 (5)	10 (25)	10 (25)
Posterm >40	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)
Maternal age (years)
<18	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)
18–35	30 (75)	6 (15)	8 (20)	8 (20)	8 (20)
>35	10 (25)	4 (10)	2 (5)	2 (5)	2 (5)
Paternal age (years)
<18	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)
18–40	28 (70)	7 (17.5)	7 (17.5)	7 (17.5)	7 (17.5)
41–55	7 (17.5)	2 (5)	1 (2.5)	3 (7.5)	1 (2.5)
>55	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)
Without data	5 (12.5)	1 (2.5)	2 (5)	0 (0)	2 (5)
Paternity
Primipaternity	27 (67.5)	10 (25)	3 (7.5)	9 (22.5)	5 (12.5)
No primipaternity	13 (32.5)	0 (0)	7 (17.5)	1 (2.5)	5 (12.5)
Maternal weight gain (kg)
<9	14 (35)	3 (7.5)	4 (10)	3 (7.5)	4 (10)
9–12	8 (20)	2 (5)	2 (5)	2 (5)	2 (5)
>12	18 (45)	5 (12.5)	4 (10)	5 (12.5)	4 (10)

Abbreviations: PE, preeclampsia; UCAA, umbilical cord anatomical abnormalities.

Table 3 VEGF family and conditions of the mother and newborns related to each group of study

Maternal diseases	Total patients (N=40), n (%)	Patients by study group, n (%)
		PE	PE and UCAA	UCAA	Normal
Clinical condition
Endocrinological diseases	4 (10)	2 (5)	0 (0)	2 (5)	0 (0)
Chronic hypertension	8 (20)	6 (15)	2 (5)	0 (0)	0 (0)
Overweight/obesity	3 (7.5)	1 (2.5)	1 (2.5)	1 (2.5)	0 (0)
Migraine	5 (12.5)	0 (0)	2 (5)	2 (5)	1 (2.5)
Thyroid cancer or history of thyroid cancer	2 (5)	1 (2.5)	0 (0)	1 (2.5)	0 (0)
Asthma/rhinitis	1 (2.5)	0 (0)	1 (2.5)	0 (0)	0 (0)
Without maternal diseases	18 (45)	2 (5)	3 (7.5)	4 (10)	9 (22.5)
Maternal complications of gestation
HDP	20 (50)	10 (25)	10 (25)	0 (0)	0 (0)
Gestational diabetes	3 (7.5)	2 (5)	1 (2.5)	0 (0)	0 (0)
Premature rupture of membranes	1 (2.5)	0 (0)	0 (0)	0 (0)	1 (2.5)
Urinary tract infection	3 (7.5)	0 (0)	0 (0)	2 (5)	1 (2.5)
Without gestacional complication	13 (32.5)	0 (0)	0 (0)	6 (15)	7 (17.5)
Neonatal complications
Hyperbilirubinemia	8 (20)	4 (10)	4 (10)	0 (0)	0 (0)
Fetal respiratory distress	7 (17.5)	3 (7.5)	4 (10)	0 (0)	0 (0)
Asymptomatic hypoglycemia	2 (5)	0 (0)	2 (5)	0 (0)	0 (0)
Congenital malformations	1 (2.5)	1 (2.5)	0 (0)	0 (0)	0 (0)
Intrauterine growth restriction	3 (7.5)	2 (5)	1 (2.5)	0 (0)	0 (0)
Stillbirth	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)
Without neonatal complication	22 (55)	3 (7.5)	1 (2.5)	9 (22.5)	9 (22.5)

Abbreviations: HDP, hypertensive disorders of pregnancy; PE, preeclampsia; UCAA, umbilical cord anatomical abnormalities.

Table 4 Umbilical cord anatomical abnormalities

Coiling number	n (%)
Hypocoiled	2 (5)
Hypercoiled	3 (7.5)
Normal coiled (0.07–0.3)	35 (87.5)
Coiling direction
Dextro	5 (12.5)
Bidirectional	2 (5)
None	0 (0)
Levo	33 (82.5)
Insertion
Marginal insertion	4 (10)
Velamentous insertion	0 (0)
Paramarginal insertion	0 (0)
Normal insertion	36 (90)
Entanglements
Tight entanglements	1 (2.5)
Without	39 (97.5)
Length
Long	4 (10)
Short	2 (5)
Without data	17 (42.5)
Normal length	17 (42.5)
Knots
True knot	1 (2.5)
True knot + bidirectional	1 (2.5)
Without knot	38 (95)
Vessels
Two vessels (single umbilical artery)	0 (0)
Three vessels	40 (100)

Figure 1 VEGF-A. Representative immunohistochemistry staining for VEGF-A in the placental disc. Positive expression demonstrated for smooth muscle of chorionic vessels, 10× (A), stromal chorionic cells, 20× (orange arrows), with positive internal control in chorionic endothelium (white arrow), and villous endothelial positivity (B), 20× (orange arrow), with negative internal control in syncytiotrophoblast (blue arrow) (C). Amnion negativity is shown 20× (D).

Figure 2 VEGF-A. Representative immunohistochemistry staining for VEGF-A in the umbilical cord.

Note: Positive expression demonstrated for smooth muscle of artery 4× (A), smooth muscle of artery (blue arrows) and endothelium 10× (orange arrow) (B), amnion (orange arrows) 10× and stromal cells (blue arrows) 20× (C and D).

Figure 3 VEGF-R1. Representative immunohistochemistry staining for VEGF-R1 in the placental disc.

Notes: Positive diffuse and strong expression demonstrated in syncytiotrophoblast 20× (B), extravillous trophoblast 4× (C), and decidua 20× (D). Chorionic plate is highlighted in (A) 10×, where trophoblast (orange arrows) and amnion (blue arrow) are prominent. Negative internal controls are seen in A and D (blue cells).

Figure 4 PLGF. Representative immunohistochemistry staining for PLGF.

Notes: (A) Diffuse and strong positivity is seen in extravillous trophoblast, basal trophoblast, and syncytiotrophoblast. In (B) strong expression of this kind of trophoblast contrasts with weak expression in decidua. In C and D, umbilical cord shows strong and diffuse expression in the endothelium and the amniotic epithelium, even though it is present in smooth muscle cells, endothelium, and stromal cells.

Figure 5 MMP1. Representative immunohistochemistry staining for MMP1 in the placental disc.

Notes: Positive expression demonstrated in trophoblast behind the basal plate 20× (A) (arrows) and smooth muscle of chorionic vessels 20× (B). Negative internal controls are shown (blue cells).

Figure 6 Immunohistochemistry summary.

Notes: Galbraith’s graphic shows the compilation of the most representative results. LCL corresponds to minor CI and UCL corresponds to major CI.
Abbreviations: HDP, hypertensive disorders of pregnancy; UCAA, umbilical cord anatomical alterations.

Figure 7 mRNA expression summary.

Notes: Bar graphs (A) and box and whisker plots (B) show differences among groups: HDP, UCAA, HDPUC, and normal gestations (CTRL). The UCAA group was unexpectedly different; sFLT1 and VEGF-A expression was consistently lower than other groups.
Abbreviations: CTRL, control; HDP, hypertensive disorders of pregnancy; HDPUC, HDP plus UCAA; UC, umbilical cord; UCAA, UC anatomical abnormalities.

Figure 8 mRNA expression summary.

Notes: mRNA expression summary. Kruskal-Wallis test revealed significant differences upon comparing UCAA group in sFlt1 expression. In the y-axis, ΔCT.
Abbreviations: HDP, hypertensive disorders of pregnancy; HDPUC, HDP plus UCAA; UC, umbilical cord; UCAA, umbilical cord anatomical abnormalities.