Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

Figures & data

Figure 1 Base-calling electropherogram of borrelial 16S rRNA gene sequencing, using M2 as the sequencing primer.

Notes: Computer-generated electropherogram is presented. BLAST alignment algorithm showed that the first unambiguous 110 bases, TTAACCCAACACCTCACAGCACGAGCTGACGACAACCATGCAGCACCTGTATATAGACCCCAAACGGGGAATAATTATCTCTAACTATATCCTATATATGTCAAGCCCTG, represent a signature sequence of the Borrelia burgdorferi sensu lato 16S rRNA gene (GenBank sequence ID CP009656, range: 445,000–445,109). Visual analysis showed that the immediately downstream 100-base segment with numerous double peaks is a composite of two superimposed sequences shown later: A:GTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACTCTTGCGAGCATACTCCCC; and B:TAAGGTTCCTAGCGTATCATCGAATTAAACCACATTCTCCACCGCTTGTGGGGGCCCCCGTCAATTCCTTTGAGTTTCACTCTTGCGAGCATACTCCCCA.
Abbreviations: BLAST, Basic Local Alignment Search Tool; rRNA, ribosomal RNA.

Figure 2 BLAST alignment report showing sequence B in the search query with a maximum 97% ID match with a common spirochete 16S rRNA gene sequence cataloged in the GenBank.

Abbreviations: BLAST, Basic Local Alignment Search Tool; rRNA, ribosomal RNA.