Asthma-like airway inflammation and responses in a rat model of atopic dermatitis induced by neonatal capsaicin treatment

Figures & data

Table 1 Severity index for the dermatitis score

Region	Score	Description
Face	0	Normal
	1	Wispy fur
	2	Alopecia or flare
	3	Bleeding or scab
Ears	0	Normal
	1	Flare
	2	Bleeding or scab
	3	Loss of the tissue
Back	0	Normal
	1	Wispy fur
	2	Alopecia or flare
	3	Bleeding or scab

Table 2 Primers used in quantitative real-time polymerase chain reaction

Gene	Primer (forward)	Primer (reverse)
GAPDH	ACTTTGGCATCGTGGAAGGG	ACATTGGGGGTAGGAACACG
IL-4	ACCTTGCTGTCACCCTGTTC	ACCTTGCTGTCACCCTGTTC
IL-5	GAGGGGGCACTGTGGAAATA	ACTCATCACGCCAAGGAACT
IL-13	CCTGGAATCCCTGACCAACA	GCCATAGCGGAAAAGTTGCT
IFN-γ	AGTTCGAGGTGAACAACCCA	CAGAATCAGCACCGACTCCT
TNF-α	GAAAGTCAGCCTCCTCTCCG	CTCCAAAGTAGACCTGCCCG

Figure 1 Schematic representation of the airway lumen and surrounding smooth muscle.

Table 3 Scoring system for measuring the amount of mucus plug in the airway

The size of mucus plug area/the size of airway lumen area (%)	Score
0–5	0
5–10	1
10–25	2
25–50	3
50–100	4

Figure 2 Atopic dermatitis-like skin inflammation, pruritus, and amplification of Th2 inflammatory reactions.

Notes: Chronological features of cutaneous inflammatory lesion (A) and scratching behaviors (B). Elevated serum IgE level was observed in the capsaicin-treated rats (C). In the skin of the capsaicin-treated rats, mRNA expression of Th2 cytokines such as IL-4, IL-5, and IL-13 was increased compared to control rats (D), but mRNA expression of Th1 cytokines such as TNF-α and IFN-γ was not significantly changed (E). ns=not significant; *p<0.05; **p<0.005.

Figure 3 Eosinophil infiltration and elevated expression of Th2 cytokines.

Notes: Representative illustration of eosinophil predominance in the BAL fluid of capsaicin-treated rats (top, A) compared to control rats (bottom, A). Arrows indicates eosinophil in BAL fluid (A). No significant difference in total number of leukocytes in BAL fluid (B). In the capsaicin-treated rats compared to control rats, differential cell count in BAL fluid demonstrated increment of eosinophil (C) and IgE level in BAL fluid markedly increased (D). In the lung of the capsaicin-treated rats, mRNA expression of Th2 cytokines such as IL-4, IL-5, and IL-13 was increased (E), but mRNA expression of Th1 cytokines such as TNF-α and IFN-γ was not altered (F). *p<0.05; ***p<0.001 (scale bar =10 μm).
Abbreviations: BAL, bronchoalveolar lavage; ns, non significant.

Figure 4 Airway remodeling and airway hyperresponsiveness.

Notes: Photographs showed hematoxylin and eosin staining of airways from the capsaicin-treated rats (top, A) and control rats (bottom, A). Arrow indicates mucus plug in the airway and double-headed arrow indicates smooth muscle thickness of the airway (A). Mucus plug markedly increased in the capsaicin-treated rats (B). Analysis of the ratio of smooth muscle thickness demonstrated smooth muscle hypertrophy in the capsaicin-treated rats (C). After exposure to increasing doses of methacholine, in the capsaicin-treated rats, the airway resistance increased at doses of 6.25, 25, and 50 mg/ml (D). Inhalation of methacholine at doses of 6.25 and 25 mg/ml markedly reduced lung compliance in the capsaicin-treated rats (E). *p<0.05 (scale bar=100 μm).

Figure S1 Increased collagen deposition in the airways.

Note: Representative slides revealed relative abundance of collagen deposition in the airways from the capsaicin-treated rats (A) compared to control rats (B) (scale bar=50 μm).