Exploration and Validation of Potential Biomarkers and Therapeutic Targets in Ferroptosis of Asthma

Figures & data

Table 1 Details of GEO Asthma Date

Accession	Platform	Species	Asthma	Non-Asthma	Gene
GSE41861	GPL570	Human	91	47	mRNA
GSE43696	GPL6480	Human	38	20	mRNA
GSE63142	GPL6480	Human	56	27	mRNA

Abbreviation: GEO, Gene Expression Omnibus.

Figure 1 The overall protocol of this study.

Abbreviations: GO, differentially expressed genes; FR-DEGs, Ferroptosis-related differentially expressed genes; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; GSEA, Gene Set Enrichment Analysis; GSVA, Gene Set Variation Analysis.

Table 2 The Primers Used in This Study

Gene	Primer-F	Primer-R
ADAMTS13	GAGGCAGAGGCAGAGGCAGAG	CCCGATGTTGAGGTTGGTGAGC
CBR1	CAGAAGTTCCGCAGTGAGACCATC	GGACAGAACGGTGACGCCAATC
ELAVL1	CATGACCCAGGATGAGTTACGAAGC	TAGTTCACAAAGCCATAGCCCAAGC
EPAS1	ACAACAACTGCCCTCCTCACAATAG	TGGCGGCTCAGGAAGGTCTTG
CREB5	TCACCAGACCTCGCCACATCC	ATCCTCGTCTACCACCCTTCGC
LRRFIP1	GGCAGCAGAAGGAGGTAGAAGAGAG	GAGAGGAAGTCCCACCCAGAGAG
MT1G	TGGACCCCAACTGCTCCTGTG	CACACTTGGCACAGCCCACAG
NOX1	CAGCAGGGGACTGGACAGAAAATC	CTCCAACCAGCACAGCCACTTC
NR1D2	TCATGCTTGCGAAGGCTGTAAGG	AGCGACATTGCTGACATCTGTTCC
VEGFA	GGTGCCCGCTGCTGTCTAATG	ACAAACAAATGCTTTCTCCGCTCTG
β-actin	CCTGGCACCCAGCACAAT	GGGCCGGACTCGTCATAC

Figure 2 The expression matrices of the GSE43696 and GSE41861datasets were normalized. (A) Boxplot of asthma and non-asthma in the GSE41861dataset; (B) Boxplot of asthma and non-asthma in the GSE43696 dataset. The green boxplot represents the asthma sample and the blue boxplot represents the control sample; (C) PCA diagrams of asthma and non-asthma in the GSE41861dataset; (D) PCA diagrams of asthma and non-asthma in the GSE43696 dataset.

Abbreviation: PCA, principal component analysis.

Table 3 13 FR-DEGs Has Been Identified as Downregulated or Upregulated in Asthma

Ensembl ID	Gene Name	Gene Type	Gene Start (bp)	Gene End (bp)	Chr no.	Status	P value	P adj
ENSG00000160323	ADAMTS13	Protein coding	133,414,337	133,459,386	9	Down	0.00107	0.04166977
ENSG00000159228	CBR1	Protein coding	36,070,024	36,073,164	21	Up	0.000286	0.02013983
ENSG00000066044	ELAVL1	Protein coding	7,958,573	8,005,641	19	Down	0.00088	0.0374346
ENSG00000116016	EPAS1	Protein coding	46,297,407	46,386,697	2	Down	0.00116	0.04364847
ENSG00000146592	CREB5	Protein coding	28,299,321	28,825,894	7	Up	0.000527	0.02799859
ENSG00000124831	LRRFIP1	Protein coding	237,527,587	237,781,643	2	Down	0.000689	0.03282089
ENSG00000125144	MT1G	Protein coding	56,666,730	56,668,065	16	Down	0.000151	0.0142877
ENSG00000007952	NOX1	Protein coding	100,843,324	100,874,359	X	Down	0.00127	0.04555435
ENSG00000174738	NR1D2	Protein coding	23,945,286	23,980,617	3	Down	0.000404	0.02426236
ENSG00000112715	VEGFA	Protein coding	43,770,209	43,786,487	6	Down	0.000897	0.03791496
ENSG00000196177	ACADSB	Protein coding	123,009,006	123,058,290	10	Down	0.00131	0.04632139
ENSG00000163291	PAQR3	Protein coding	78,887,076	78,939,438	4	Down	0.00133	0.04669752
ENSG00000168610	STAT3	Protein coding	42,313,324	42,388,442	17	Down	0.000572	0.02926981

Notes: The columns indicate the Ensembl ID, Gene name, Gene type, Gene start (bp), Gene end (bp), Chromosome number, Status=Up/Downregulated, p-value, p adj respectively. FR-DEGs were selected with p adj<0.05.

Figure 3 FR-DEGs of the GSE41861 and GSE43696 datasets. (A) The volcano plot presenting the DEGs in asthma and non-asthma in the GSE41861 dataset; (B) The volcano plot presenting the DEGs in asthma and non-asthma in the GSE43696 dataset. Red, upregulated genes; green, downregulated genes; black, no significant differences; (C) Venn diagram of DEGs, DEGs in the GSE41861 and GSE43696 datasets of asthma and non-asthma; (D) Venn diagram of FR-DEGs, the intersection of common DEGs of asthma and non-asthma in GSE41861 and GSE43696 datasets and ferroptosis database genes; (E) Heat maps of 13 FR-DEGs from the GSE41861 dataset; (F) Heat maps of 13 FR-DEGs from the GSE43696 dataset. The color of the small squares represents the size of the gene expression, with red representing high-expression genes and blue representing low-expression genes.

Figure 4 Enrichment functional analyses of the 13 FR-DEGs. (A) Bubble plot of GO enrichment analysis of the 13 FR-DEGs; (B) Circle diagram of GO enrichment analysis of the 13 FR-DEGs. (C) Bubble plot of KEGG enrichment analysis of the 13 FR-DEGs. (D) Bubble plot of Reactome pathway analysis of the 13 FR-DEGs.

Abbreviations: BP, biological process; CC, cell composition; MF, molecular function; KEGG, Kyoto encyclopedia of genes and genomes.

Figure 5 MiRNA-mRNA regulatory network of FR-DEGs. The network included 191 nodes (178 miRNAs and 13 genes) and 370 edges.

Figure 6 Single-gene GSEA enrichment analysis in 13 FR-DEGs. (A) ACADSB, (B) ADAMTS13, (C) CBR1, (D) CREB5, (E) ELAVL1, (F) EPAS1, (G) LRRFIP1, (H) MT1G, (I) NOX1, (J) NR1D2, (K) PAQR3, (L) STAT3, (M) VEGFA.

Figure 7 GSVA pathway analysis. High‐ and low‐expression groups in asthma-vs-controls (A) and controls -vs- asthma (B).

Figure 8 Immune infiltration analysis. (A) Immune landscape analysis between asthma and non-asthma samples which implemented the CIBERSORT algorithm. (B) Pearson correlation analysis between 13 FR-DEGs and immune cells. *P<0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001.

Figure 9 Prediction of gene‐targeted drugs (VEGFA, STAT3, NOX1, ELAVL1, EPAS1 and CBR1), The drugs may target genes through the DGIdb database.

Figure 10 Expression levels of the 10 FR-DEGs in asthma and non-asthma in the GSE631421 dataset. (A) ADAMTS13’ expression in the GSE631421 dataset; (B) CBR1’ expression in the GSE631421 dataset; (C) ELAVL1’ expression in the GSE631421 dataset; (D) CREB5’ expression in the GSE631421 dataset; (E) EPAS1’ expression in the GSE631421 dataset; (F) LRRFIP1’ expression in the GSE631421 dataset; (G) MT1G’ expression in the GSE631421 dataset; (H) NOX1’ expression in the GSE631421 dataset; (I) NR1D2’ expression in the GSE631421 dataset; (J) VEGFA’ expression in the GSE631421 dataset. *P<0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001.

Figure 11 Diagnostic ROC curves of 10 FR-DEGs in the GSE631421 dataset. (A) ROC curve of ADAMTS13; (B) ROC curve of CBR1; (C) ROC curve of ELAVL1; (D) ROC curve of CREB5; (E) ROC curve of EPAS1; (F) ROC curve of LRRFIP1; (G) ROC curve of MT1G; (H) ROC curve of NOX1; (I) ROC curve of NR1D2; (J) ROC curve of VEGFA.

Abbreviation: ROC, receiver operating characteristic.

Table 4 Characteristics of Asthma and Control in This Study

Characteristics	Total (n=60)	Asthma (n=30)	Control (n=30)	P-value
Age (years)	42.9±11.4	44.9±12.9	40.9±9.6	0.18
Male (n, %)	27 (45.0%)	14 (46.7%)	13 (43.3%)	-
BMI (kg/m^2)	24.4±3.0	24.2±2.9	24.7±3.1	0.58
FEV1 (L)	2.8±0.9	2.1±0.7	3.5±0.5	<0.01
FEV1/FVC (%)	79.0±16.8	64.8±8.6	93.2±9.0	<0.01
IgE (ng/mL)	55.0±49.4	87.5±51.3	22.5±12.2	<0.01

Note: Numeric and categorical variables were reported as mean ± SD and N (%), respectively.

Abbreviation: BMI, body mass index.

Figure 12 Validation of mRNA levels of 10 FR-DEGs in asthma patients and healthy controls. (A) mRNA levels of ADAMTS13; (B) mRNA levels of CBR1; (C) mRNA levels of ELAVL1; (D) mRNA levels of CREB5; (E) mRNA levels of EPAS1; (F) mRNA levels of LRRFIP1; (G) mRNA levels of MT1G; (H) mRNA levels of NOX1; (I) mRNA levels of NR1D2; (J) mRNA levels of VEGFA. **P≤0.01, ***P≤0.001, ****P≤0.0001.