Dependence of the severity of the systemic inflammatory response on resistance to hypoxia in male Wistar rats

Figures & data

Table 1 PCR primer structures and targets definition

Target symbol	Direction	Sequence (5′–3′)	NCBI Ref. Seq.	Target definition
B2m	Forward	CTCGCTCGGTGACCGTGAT	NM_012512.2	Rattus norvegicus B2m, mRNA
	Reverse	GGACAGATCTGACATCTCGA
Hif-1a	Forward	GAGCCTTAACCTATCTGTCA	NM_024359.1	R. norvegicus Hif1α, mRNA
	Reverse	CACAATCGTAACTGGTCAGC
Nf-kb	Forward	GACGATCCTTTCGGAACTG	NM_001276711.1	R. norvegicus Nfkb1, mRNA
	Reverse	GCATATGCCGTCCTCACAG

Abbreviations: B2m, beta-2 microglobulin; Hif1α, hypoxia-inducible factor 1 alpha subunit; Nfkb1, nuclear factor kappa B subunit 1.

Figure 1 Expression of Nf-kb in the liver of rats tolerant and susceptible to hypoxia after 3, 6 and 24 hours of LPS administration (Me; 25%–75%).

Notes: In all groups there were 5 observations except the tolerant group after 24 hours of LPS injection, in which were 8. Statistical significance of differences (P-value) is determined by the Kruskal–Wallis method.

Abbreviation: LPS, lipopolysaccharide.

Table 2 The expression level of mRNA Nf-kb and Hif-1α in the liver of rats tolerant and susceptible to hypoxia after 3, 6 and 24 hours of LPS administration (Me; 25%–75%)

Level of relative expression of mRNA in the liver	Control			LPS
				3 hours			6 hours			24 hours
	Tolerant (1)	Susceptible (2)	P-value (1–2)	Tolerant (3)	Susceptible (4)	P-value (3–4)	Tolerant (5)	Susceptible (6)	P-value (5–6)	Tolerant (7)	Susceptible (8)	P-value (7–8)
Nf-kb	0.00005 (0.00001–0.0001)	0.0001 (0.000001–0.0002)	0.91	0.0001 (0.00006–0.0004)	0.0003 (0.0001–0.0006)	0.19	0.0002 (0.00004–0.0006)	0.0006 (0.0005–0.0009)	0.02	0.00002 (0.000008–0.00006)	0.0002 (0.00007–0.0004)	0.004
Hif-1a	0.000009 (0.000002–0.00002)	0.0006 (0.0001–0.0009)	0.02	0.0003 (0.00002–0.0004)	0.0001 (0.00005–0.0003)	0.57	0.0009 (0.0001–0.002)	0.002 (0.002–0.003)	0.02	0.00002 (0.000007–0.00004)	0.0002 (0.00002–0.0003)	0.02

Note: Statistical significance of differences (P-value) is determined by the Mann–Whitney U test. Bold font represents statistically significant differences.

Abbreviation: LPS, lipopolysaccharide.

Figure 2 Expression of Hif-1α in the liver of rats tolerant and susceptible to hypoxia after 3, 6 and 24 hours of LPS administration (Me; 25%–75%).

Notes: In all groups there were 5 observations except the tolerant group after 24 hours of LPS injection, in which were 8. Statistical significance of differences (P-value) is determined by the Kruskal–Wallis method.

Abbreviation: LPS, lipopolysaccharide.

Table 3 The serum IL-1β and spleen IL-10 levels in rats tolerant and susceptible to hypoxia after 3, 6 and 24 hours of LPS administration (Me; 25%–75%)

Cytokines	Control			LPS
				3 hours			6 hours			24 hours
	Tolerant (1)	Susceptible (2)	P-value (1–2)	Tolerant (3)	Susceptible (4)	P-value (3–4)	Tolerant (5)	Susceptible (6)	P-value (5–6)	Tolerant (7)	Susceptible (8)	P-value (7–8)
IL-1β in serum, pg/mL	1.7 (0.8–8.8)	3.0 (0.9–8.2)	0.77	14.2 (10.3–22.1)	40.0 (21.7–49.4)	0.05	3.2 (1.7–15.2)	6.0 (1.1–10.5)	0.81	2.6 (0.0–7.1)	15.7 (7.5–18.3)	0.04
IL-10 in the culture fluid of splenic cells, pg/mL	44.2 (44.2–45.6)	32.6 (31.2–38.4)	0.07	50.0 (47.1–51.4)	41.3 (39.9–48.5)	0.46	32.6 (31.2–34.1)	45.6 (34.1–47.1)	0.07	41.3 (29.0–44.9)	26.8 (20.1–31.2)	0.04

Note: Statistical significance of differences (P-value) is determined by the Mann–Whitney U test. Bold font represents statistically significant differences.

Abbreviation: LPS, lipopolysaccharide.

Figure 3 Serum IL-1β levels in rats tolerant and susceptible to hypoxia after 3, 6 and 24 hours of LPS administration (Me; 25%–75%).

Notes: In all groups there were 5 observations except the tolerant group after 24 hours of LPS injection, in which were 8. Statistical significance of differences (P-value) is determined by the Kruskal–Wallis method.

Abbreviation: LPS, lipopolysaccharide.

Figure 4 IL-10 production by spleen cells activated by Concanavalin A in rats tolerant and susceptible to hypoxia after 3, 6 and 24 hours of LPS administration (Me; 25%–75%).

Notes: In all groups there were 5 observations except the tolerant group after 24 hours of LPS injection, in which were 8. Statistical significance of differences (P-value) is determined by the Kruskal–Wallis method.

Abbreviation: LPS, lipopolysaccharide.

Table 4 serum TGF-β level in rats tolerant and susceptible to hypoxia after 3, 6 and 24 hours of LPS administration (Me; 25%–75%)

	Control			LPS
				3 hours			6 hours			24 hours
	Tolerant (1)	Susceptible (2)	P-value (1–2)	Tolerant (3)	Susceptible (4)	P-value (3–4)	Tolerant (5)	Susceptible (6)	P-value (5–6)	Tolerant (7)	Susceptible (8)	P-value (7–8)
TGF-β, pg/mL	58,238.6 (48,295.5–69,602.3)	49,715.9 (45,454.5–52,556.8)	0.29	44,034.1 (41,193.2–49,715.9)	44,744.4 (29,474.5–57,528.4)	0.90	35,511.4 (28,645.8–48,295.5)	24,739.6 (22,135.4–31,250.0)	0.09	27,343.8 (22,135.4–31,250.0)	38,352.3 (31,250.0–48,295.5)	0.06

Note: Statistical significance of differences (P-value) is determined by the Mann–Whitney U test.

Abbreviation: LPS, lipopolysaccharide.

Figure 5 TGF-β serum levels in rats tolerant and susceptible to hypoxia after 3, 6 and 24 hours of LPS administration (Me; 25%–75%).

Notes: In all groups there were 5 observations except the tolerant group after 24 hours of LPS injection, in which were 8. Statistical significance of differences (P-value) is determined by the Kruskal–Wallis method.

Abbreviation: LPS, lipopolysaccharide.

Figure 6 Morphological changes in the lungs of male Wistar rats tolerant and susceptible to hypoxia after 3, 6 and 24 hours of LPS administration.

Notes: H&E staining. Original magnification: (A–H) 640×. (A) Rats tolerant to hypoxia, control group – few neutrophils in the field of view. (B) Rats susceptible to hypoxia, control group – few neutrophils in the field of view. (C) Rats tolerant to hypoxia, 3 hours LPS – thickened interalveolar septa with neutrophils, hyperemia. (D) Rats susceptible to hypoxia, 3 hours LPS – pronounced neutrophil infiltration in interalveolar septa, hyperemia. (E) Rats tolerant to hypoxia, 6 hours LPS – neutrophil infiltration in interalveolar septa, hyperemia. (F) Rats susceptible to hypoxia, 6 hours LPS – high number of neutrophils in interalveolar septa, hyperemia. (G) Rats tolerant to hypoxia, 24 hours LPS – interalveolar septa with neutrophils, hyperemia. (H) Rats susceptible to hypoxia, 24 hours LPS – interalveolar septa with neutrophils, hyperemia.

Abbreviation: LPS, lipopolysaccharide.

Figure 7 The average number of neutrophils counted in ten high-power fields of view (25,000 µm²) per section in the interalveolar septa of the lungs of rats tolerant and susceptible to hypoxia after 3, 6 and 24 hours of LPS administration (Me; 25%–75%).

Notes: In all groups there were 5 observations except the tolerant group after 24 hours of LPS injection, in which were 8. Statistical significance of differences (P-value) is determined by the Kruskal–Wallis method.

Abbreviation: LPS, lipopolysaccharide.

Table 5 summary of results

Index	Organ	Tolerant	Susceptible
mRNA Hif-1α	Liver	Increased after 6 hours of LPS injection	Increased after 6 hours of LPS injection In the control group, after 6 and 24 hours of LPS injection, it was higher than in tolerant animals
mRNA Nf-kb		No changes	Increased after 3 and 6 hours of LPS injection. After 6 and 24 hours, it was higher than in tolerant animals
IL-1β	Serum	No changes	Increased after 3 hours of LPS injection After 24 hours, it was higher than in tolerant animals
C-reactive protein	Serum	No changes	Increased after 24 hours of LPS injection
IL-10	Culture fluid of splenic cells	Decreased after 6 hours of LPS injection after 24 hours, it was higher than in the susceptible animals	No changes
TGF-β	Serum	Decreased after 24 hours of LPS injection	no changes
Number of neutrophils	Lungs	Increased after 3 and 6 hours of LPS injection	Increased after 3 and 6 hours of LPS injection. After 6 hours, it was higher than in tolerant animals

Abbreviation: LPS, lipopolysaccharide.