Ex vivo stimulation of whole blood as a means to determine glucocorticoid sensitivity

Figures & data

Table 1 Demographics of normal human subjects (n = 12)

Age, mean ± 1 SD	32.7 ± 7.3 years
Sex	8 female/4 male
Race	10 Caucasian/1 Asian/1 other

Abbreviation: SD, standard deviation.

Table 2 Real-time PCR primers

Target	Forward primer (5′-3′)	Reverse primer (5′-3′)
GILZ	gcacaatttctccatctccttctt	tcagatgattcttcaccagatcca
FKBP51	tccctcgaatgcaactctct	aaacatccttccaccacagc
FLAP	gcgtttgctggactgatgta	aatatgccagcaacggacat
MKP-1	ctgccttgatcaacgtctca	acccttcctccagcattctt

Abbreviations: GILZ, glucocorticoid inducible leucine zipper; FKBP51, FK506 binding protein 51; FLAP, arachidonate 5-lipoxygenase-activating protein; MKP-1, mitogen activated protein kinase phosphatase 1.

Figure 1 Whole blood was stimulated with 100 nM dexamethasone (A) or 1 ng/mL LPS with and without 100 nM dexamethasone (B) for 2 hours. RNA was isolated and cDNA transcribed. Real-time PCR was performed to determine expression of the GR upregulated genes GILZ, FKBP51, FLAP, and MKP-1 (A) and the GR downregulated genes IL-6, TNFα, and IFNγ (B). The expression of these genes was normalized to the housekeeping genes GAPDH and CAP-1. ΔΔ Ct was calculated for GILZ, FKBP51, FLAP, and MKP-1 as treatment (dexamethasone) against no treatment (A) and for IL-6, TNFα, and IFNγ as treatment (dexamethasone + LPS) against LPS only.

Note: Box plots with whiskers identifying outliers 1.5 times the IQR either above the 3rd quartile or below the 1st quartile are shown from 12 individuals.
Abbreviations: LPS, lipopolysaccharide; PCR, polymerase chain reaction; GR, glucocorticoid receptor; GILZ, glucocorticoid inducible leucine zipper; FKBP51, FK506 binding protein 51; FLAP, arachidonate 5-lipoxygenase-activating protein; MKP- 1, mitogen activated protein kinase phosphatase 1; IL-6, interleukin 6; TNFα, tumor necrosis factor α; IFNγ, interferon γ; IQR, interquartile range; CAP-1, cyclic AMPaccessory protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Figure 2 Whole blood was stimulated with increasing amounts of dexamethasone (A) or 1 ng/mL LPS with and without increasing concentrations of dexamethasone (B) for 2 hours. RNA was isolated and cDNA transcribed. Real-time PCR was performed to determine expression of the GR upregulated genes GILZ and FKBP51 (A) and the GR downregulated genes IL-6 and TNFα (B). The expression of these genes was normalized to the housekeeping genes GAPDH and CAP-1. Dose response curves were drawn and the EC₅₀ (A) and IC₅₀ (B) values were calculated.

Note: Box plots with whiskers identifying outliers 1.5 times the IQR either above the 3rd quartile or below the 1st quartile are shown from 9 individuals.
Abbreviations: LPS, lipopolysaccharide; PCR, polymerase chain reaction; GR, glucocorticoid receptor; GILZ, glucocorticoid inducible leucine zipper; IL-6, interleukin 6; TNFα, tumor necrosis factor α; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CAP-1, cyclic AMP-accessory protein; EC₅₀, half maximal effective concentration; IC₅₀, half maximal inhibitory concentration; IQR, interquartile range.

Figure 3 Whole blood was drawn from 10 individuals at 8:30 am, 12:30 pm, 4:30 pm, and 8:30 pm and was stimulated with 100 nM dexamethasone (A and B) or 1 ng/mL LPS with and without 100 nM dexamethasone (C and D) for 2 hours. RNA was isolated and cDNA transcribed. Real-time PCR was performed to determine expression of the GR upregulated genes GILZ (A) and FKBP51 (B) and the GR downregulated genes IL-6 (C) and TNFα (D).

Notes: The expression of these genes was normalized to the housekeeping genes GAPDH and CAP-1. ΔΔCt was calculated for GILZ and FKBP51 as treatment (dexamethasone) against no treatment and for IL-6 and TNFα as treatment (dexamethasone + LPS) against LPS only. The slope of the ΔΔCt value was calculated and tested for significance using a random-effects linear regression analysis.
Abbreviations: LPS, lipopolysaccharide; PCR, polymerase chain reaction; GR, glucocorticoid receptor; GILZ, glucocorticoid inducible leucine zipper; FKBP51, FK506 binding protein 51; IL-6, interleukin 6; TNFα, tumor necrosis factor α; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CAP-1, cyclic AMP-accessory protein; ΔΔCt, comparative cycle threshold.

Figure 4 Whole blood from 10 individuals was either treated immediately (closed square) or stored in the EDTA tube at 4°C for 24 hours (open square) prior to stimulation with 100 nM dexamethasone (A) or 1 ng/mL LPS with and without 100 nM dexamethasone (B) for 2 hours. RNA was isolated and cDNA transcribed. Real-time PCR was performed to determine the expression of the GR upregulated genes GILZ and FKBP51 (A) and the GR downregulated genes IL-6 and TNFα (B).

Notes: The expression of these genes was normalized to the housekeeping genes GAPDH and CAP-1. ΔΔCt was calculated for GILZ and FKBP51 as treatment (dexamethasone) against no treatment and for IL-6 and TNFα as treatment (dexamethasone + LPS) against LPS only.
Abbreviations: LPS, lipopolysaccharide; PCR, polymerase chain reaction; GR, glucocorticoid receptor; GILZ, glucocorticoid inducible leucine zipper; FKBP51, FK506 binding protein 51; IL-6, interleukin 6; TNFα, tumor necrosis factor α; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CAP-1, cyclic AMP-accessory protein; ΔΔCt, comparative cycle threshold.

Figure 5 Whole blood was drawn at 8:30 am and stimulated with 1 ng/mL LPS with and without 100 nM dexamethasone for 2 hours for real-time PCR or 24 hours for ELISA.

Notes: For real-time PCR, RNA was isolated, cDNA transcribed, and real-time PCR performed to determine expression of IL-6 mRNA. The expression of IL-6 was normalized to the housekeeping genes GAPDH and CAP-1. For EL ISA, serum was separated and IL-6 protein determined using the Human IL-6 EL IZA MAX Set Deluxe Kit (Biolegend). Upon stimulation with 1 ng/mL, 702 ± 922 pg/mL IL-6 was detected. When co-stimulated with dexamethasone 19 ± 22 pg/mL IL-6 was detected. The percentage repression by dexamethasone was calculated by the difference in fold induction by LPS with and without dexamethasone as a percentage of the fold induction by LPS alone. Means and SD are shown from 12 individuals. The two groups were tested for significance using a student’s t-test.
Abbreviations: LPS, lipopolysaccharide; PCR, polymerase chain reaction; EL ISA, enzyme-linked immunosorbent assay; IL-6, interleukin 6; GAPDH, glyceraldehyde- 3-phosphate dehydrogenase; CAP-1, cyclic AMP-accessory protein; SD, standard deviation.

Table 3 Coefficient of variation over gene

Gene	Form	Figure	CV	Median	IQR
GILZ	ΔΔCT	1	0.149	−2.24	−2.39 to −2.05
FKBP51	ΔΔCT	1	0.306	−2.21	−2.27 to −1.82
FLAP	ΔΔCT	1	0.460	−0.62	−0.81 to −0.43
MKP-1	ΔΔCT	1	0.462	−1.60	−1.87 to −0.93
IL6	Repression	1	0.113	92.9	87.6 to 94.8
TNFα	Repression	1	0.211	71.0	59.5 to 82.3
IFNγ	Repression	1	0.053	93.1	88.0 to 95.4
GILZ	EC50	2	1.029	5.26	1.78 to 6.58
FKBP51	EC50	2	0.556	21.0	17.9 to 37.8
IL-6	IC50	2	3.086	0.03	0.00 to 0.11
TNFα	IC50	2	2.430	0.88	0.59 to 2.24

Abbreviations: GILZ, glucocorticoid inducible leucine zipper; FKBP51, FK506 binding protein 51; FLAP, arachidonate 5-lipoxygenase-activating protein; MKP-1, mitogen activated protein kinase phosphatase 1; IL-6, interleukin 6; TNFα, tumor necrosis factor α; IFNγ, interferon γ.

Table 4 Descriptive statistics by figure, gene, and time

Figure	Gene	Time	Median	IQR
3	FKBP51	0	−2.18	−2.26 to −1.63
3	FKBP51	4	−2.59	−2.69 to −2.48
3	FKBP51	8	−2.67	−2.83 to −2.45
3	FKBP51	12	−2.65	−2.82 to −2.61
3	GILZ	0	−2.21	−2.42 to −2.00
3	GILZ	4	−2.03	−2.33 to −1.97
3	GILZ	8	−2.27	−2.66 to −2.20
3	GILZ	12	−2.58	−2.75 to −2.39
3	IL-6	0	90.9	86.3 to 94.9
3	IL-6	4	93.7	92.8 to 96.2
3	IL-6	8	94.0	93.1 to 96.7
3	IL-6	12	94.5	92.0 to 96.2
3	TNFα	0	72.2	58.9 to 82.5
3	TNFα	4	80.4	72.4 to 89.2
3	TNFα	8	78.8	66.9 to 88.5
3	TNFα	12	75.0	65.8 to 79.8
4	FKBP51	Pre	−2.18	−2.26 to −1.63
4	FKBP51	Post	−1.92	−2.42 to −1.70
4	GILZ	Pre	−2.21	−2.42 to −2.00
4	GILZ	Post	−1.73	−2.12 to −1.45
4	IL6	Pre	90.9	86.3 to 94.9
4	IL6	Post	84.7	81.8 to 90.0
4	TNFα	Pre	72.2	58.9 to 82.5
4	TNFα	Post	68.6	57.5 to 72.5
5	IL-6	Pre	90.9	83.6 to 94.0
5	IL-6	Post	98.9	96.6 to 99.7

Abbreviations: IQR, interquartile range; FKBP51, FK506 binding protein 51; GILZ, glucocorticoid inducible leucine zipper; IL-6, interleukin 6; TNFα, tumor necrosis factor α.