Doxorubicin-Induced Cardiotoxicity May Be Alleviated by Bone Marrow Mesenchymal Stem Cell-Derived Exosomal lncRNA via Inhibiting Inflammation

Figures & data

Table 1 The Primer Sequence for qRT-PCR

Primer	Forward	Reverse
GAPDH	AAATGGTGAAGGTCGGTGTGAAC	CAACAATCTCCACTTTGCCACTG
IL-6	ACAGAAGGAGTGGCTAAGGA	AGGCATAACGCACTAGGTTT
MSTRG.75967.15	GCTATCCACTTCACTTTTCCA	TCTACCCAACTCCTACCTTCTC
MSTRG.51708.15	CATTCTCTACCCTGCTTCGT	GCTACCTTCCTTGCTGTGTT
MSTRG.98097.4	AGAGGATGAGATACACAGGCA	TCAGGAGGCTAAACAGAAGG
ENSMUST00000162380	TAGTTCTTGGCGGTTTCAGT	CTCCCTCCGTCTCTCATTC
MSTRG.94952.19	CAGTCATCTCTCTATCCCCTTT	CTCAGGGTAGTTCAGTGTTCC
MSTRG.4585.1	GCATTAGAGAAACCAACACAGA	GAAACATAGGAGGGAACAAGAG
MSTRG.79460.7	CGTGAAGACCAGAGGACAA	GTGGAGACCAGTGATACAAGG
MSTRG.38414.10	CAGGAAAGATGACCAGAGGA	GGGGATGTGAAGTGTTGTG
MSTRG.58791.2	TCCTTATGCTTTCTTACGATTCT	CAGTCTTTCCAGTTCTCTTGG
MSTRG.12633.8	GGAGAGGCACAAAATAGAGG	AAGCAGAACCATAGGACAGC

Figure 1 Quality control of the lncRNAs. (A) Prediction of lncRNAs from four softwares. (B) Classification of lncRNAs in the samples. (C) Expression level of lncRNAs in two groups. (D) Density of lncRNAs in two groups. (E) The cumulative distribution of conservative scores for lncRNA and mRNA. (F) Conservative score cumulative distribution. (G) Conservative score probability density curve.

Figure 2 The difference expression of lncRNAs analysis. (A) The correlation analysis between the DOX group and BEC group. (B) The volcano plot of up- and downregulated lncRNAs in BEC group compared with DOX group. (C) The hierarchical clustering and difference of lncRNAs between the two groups.

Table 2 The Top 10 ElncRNAs in the BEC Group

#ID	Gene Symbol	FDR	log2FC
MSTRG.75967.15	MSTRG.75967.15	5.42443667337116e-13	11.4600038610119
MSTRG.51708.15	MSTRG.51708.15	5.8756853381905e-13	13.1167967798597
MSTRG.98097.4	MSTRG.98097.4	3.23018583900885e-11	11.182354925168
ENSMUST00000162380	4933413C19Rik-201	4.75803514666033e-11	10.7524877343357
MSTRG.94952.19	MSTRG.94952.19	7.80723842820196e-11	10.2750351208207
MSTRG.4585.1	MSTRG.4585.1	1.23559402741018e-10	10.1592494783464
MSTRG.79460.7	MSTRG.79460.7	1.81601942028659e-10	11.6374422495268
MSTRG.38414.10	MSTRG.38414.10	5.11526492667872e-10	9.9517968399127
MSTRG.58791.2	MSTRG.58791.2	5.72877434917132e-10	9.69214161606425
MSTRG.12633.8	MSTRG.12633.8	6.37378605363441e-10	9.565391746026

Figure 3 The GO enrichment analysis of cis_targets of ElncRNAs. (A) Enrichment analysis of biological process (BP) of cis_targets. (B) Enrichment analysis of cellular component (CC) of cis_targets. (C) Enrichment analysis of molecular function (MF) of cis_targets.

Figure 4 The KEGG analysis of cis_targets of ElncRNAs. (A) The enrichment of pathways of cis_targets. (B) The whole outlook of enriched pathways, including cellular process, environmental processing, genetic information processing, human diseases and original systems, of cis_targets.

Figure 5 The crucial signaling pathways. (A) The chemokine signaling pathway. (B) The cellular senescence signaling pathway. (C) The mTOR signaling pathway. (D) The p53 signaling pathway.

Figure 6 The cell verification experiments. (A) The CCK-8 assay. (B) The ROS experiment (The scale bar is 100μm). (C) The relative expression of IL-6 in each group. (D) The relative expression of MSTRG.75967.15 in each group. (E) The relative expression of MSTRG.51708.15 in each group. (F) The relative expression of MSTRG.98097.4 in each group. (G) The relative expression of ENSMUST00000162380 in each group. (H) The relative expression of MSTRG.94952.19 in each group. (I) The relative expression of MSTRG.4585.1 in each group. (J) The relative expression of MSTRG.79460.7 in each group. (K) The relative expression of MSTRG.38414.10 in each group. (L) The relative expression of MSTRG.58791.2 in each group. (M) The relative expression of MSTRG.12633.8 in each group. (ns, p > 0.05; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.).

Table 3 The Target Genes of MSTRG.58791.2 and MSTRG.98097.4

LncRNA	Target Genes	Common Target Genes
MSTRG.58791.2	Slfn4, Pdgfb, Hk2, Cd52, Ccl3, Acp5, Il7r, Ndrg1, Mmp8, Atp1a2, Rarres2, Kcnq1, Cox4i2, Cybb, Ncf1, Cd274, Aldoc, Ccl4, Adarb1, Pfkl, Tppp, Fyb, Cd86, Wnt10b, Ache, Tpi1, Slc5a7, Vegfa, Sik1, C3, Slc15a3, Slc16a3, Gpr35, Slamf9, Traf1, Psd4, Il1rn, Il1a, Sema4a, Car9, Pramef12, Slc10a6, Clec5a, Plbd1, Coro1a, Itgal, Arhgap4, Egln1, Oas3, Nlrp3, Rac2, Rasd2, Unc13a, Igsf6, Egln3, Abhd18, Tgm2, Prdm1, Metrnl, Dock3, Fmo2, Milr1, Atp1a3, Atp1b2, Kif21b, Efhc1, Trem1, Dusp15, Mrap2, Ccrl2, Smtnl2, Mmp10, Tmem196, C5ar1, Tifab, Nlrp10, Oprd1, Rtn4rl2, Spn, Cysltr1, Prelid2, Osm, Ldha, Cenpm, Gm8225, Selenbp1, Tmem35b, Tigit, Csf2rb, Cpne1, Gal3st4, Slfn1, Tmem182, Bcl2a1b, Bcl2a1d, Bcl2a1a, Gm43720	Pdgfb, Hk2, Cd52, Ccl3, Acp5, Il7r, Ndrg1, Mmp8, Atp1a2, Rarres2, Kcnq1, Cox4i2, Cybb, Ncf1, Aldoc, Ccl4, Adarb1, Pfkl, Tppp, Fyb, Cd86, Wnt10b, Ache, Tpi1, Slc5a7, Vegfa, Sik1, C3, Slc15a3, Slc16a3, Gpr35, Slamf9, Psd4, Il1rn, Sema4a, Car9, Pramef12, Slc10a6, Plbd1, Itgal, Arhgap4, Egln1, Oas3, Nlrp3, Rac2, Rasd2, Unc13a, Igsf6, Egln3, Abhd18, Tgm2, Prdm1, Metrnl, Dock3, Fmo2, Milr1, Atp1a3, Atp1b2, Kif21b, Efhc1, Trem1, Dusp15, Mrap2, Ccrl2, Smtnl2, Mmp10, Tmem196, C5ar1, Tifab, Nlrp10, Oprd1, Rtn4rl2, Spn, Cysltr1, Prelid2, Osm, Ldha, Cenpm, Gm8225, Selenbp1, Tmem35b, Tigit, Csf2rb, Cpne1, Gal3st4, Slfn1, Tmem182, Bcl2a1b, Bcl2a1d, Bcl2a1a, Gm43720
MSTRG.98097.4	Pdgfb, Hk2, Cd52, Ccl3, Acp5, Tbc1d8, Cp, Il7r, Cd33, Pgf, Slc2a9, Ndrg1, Mmp8, Pdk1, Atp1a2, Rarres2, Kcnq1, Cox4i2, Hyal1, Exoc3l2, Aldh1a3, Cybb, Ncf1, Ift27, Aldoc, Stac2, Myh11, P4ha2, Ccl4, Plod1, Arg1, Adarb1, Pfkl, Fstl3, Adcy2, Tppp, Thbs4, Ero1l, Ednrb, Fyb, Efs, Tgm1, Gtse1, Samsn1, Cd86, Wnt10b, Bsg, Ache, Tpi1, Slc5a7, Vegfa, Sik1, C3, Lvrn, Lox, Slc15a3, Cst6, Vldlr, Slc16a3, Adam8, Alox5, Gpr35, Slamf9, Psd4, Il1rn, Prrg4, Gss, Wisp2, Efna3, Sema4a, Car9, Ak4, Pramef12, Slc2a1, Sytl1, Ppp2r2c, Slc10a6, 1700003E16Rik, Plbd1, Itgal, Mmp15, Egln1, St14, Pdgfd, 4833427G06Rik, Trf, Nlrp3, Rac2, Dpyd, Rasd2, Celf5, Igsf6, Egln3, Prtg, Slc18a1, Pafah2, Tgm2, Zfp365, Pln, Metrnl, Dock3, Maob, Thbs1, Fmo2, Nxph4, Milr1, Cmtm5, Atp1a3, Atp1b2, Kif21b, Efhc1, Trem1, AA986860, Dusp15, Apobr, Mrap2, Foxf1, Mmp3, Ccrl2, Kcnj4, S1pr1, Smtnl2, Adamts6, Nexmif, Dusp28, Mmp10, Stbd1, Palm3, Tmem196, Tmem229a, Zbtb8b, C5ar1, Scn3b, Tifab, Nlrp10, Ppp1r3g, Oprd1, Rtn4rl2, Ankrd37, Ppp1r36, Cysltr1, Gpr141, Arhgap20, Cthrc1, Triqk, Prelid2, Usp13, Lmcd1, Nkx2-9, Osm, Pgk1, Ldha, Eno1, Hhip, Cenpm, Gm8225, Gm4841, Trp53i11, Selenbp1, Tmem35b, Tigit, Csf2rb, Fam196a, C5ar2, Cpne1, Pak6, Gal3st4, Slfn1, Naip2, Bcl2a1b, Sec14l5, Gm7942, Bcl2a1d, Bcl2a1a, Gm43720, Zscan4-ps1

Figure 7 The lncRNA-mRNA network between two candidate lncRNAs and their target genes. (A) The common target genes of MSTRG.58791.2 and MSTRG.98097.4. (B) The network and core genes involving in DIC.

Figure 8 The verification experiments in vivo. (A) Exosomes photographed by transmission electron microscopy (TEM). (B) The nanoparticle diameter identified by NTA. (C) The schematic design of animal experiment. (D) The survival rate of different groups (p<0.05). (E) The Sirius Red Staining. (F) The relative expression of IL-1β. (G) The relative expression of IL-6 in each group. (H) The relative expression of MSTRG.58791.2 in each group. (I) The relative expression of MSTRG.98097.4 in each group. (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001).

Figure 9 The whole process of the study.