Transcriptomics Analysis Revealed Key Genes Associated with Macrophage Autophagolysosome in Male ApoE^−/− Mice Aortic Atherosclerosis

Figures & data

Figure 1 Carotid artery ultrasonography and aorta sampling in ApoE^−/− mice. (A) B-ultrasound and Doppler images of the left carotid artery of mice were collected and imported into the VevoLAB3.2.6 system to calculate the vascular resistance index (RI). The red arrow points to the left carotid artery of the ApoE^−/− mice under ultrasound. (B) Carotid artery ultrasonography showed that RI in AS22W was significantly higher than that in the other three groups (P<0.0001) (ns p≥0.05, ****p<0.0001). (C) Stripping the hearts and aortas. The red arrow points to the aortic atheromatous plaque of the ApoE^−/− mice in AS22W group under direct vision.

Table 1 Gene-Specific Primers Used for Real-Time RT-PCR

Gene	Forward Primer (5’→3’)	Reverse Primer (5’→3’)
Atp6v1a	CTATGAGCGAGCAGGCAGAGT	TACCCAGCGTTGCAGAAGTGA
Atp6v1d	AACTGGCTTCCCTGCAGACTT	TAGGCAAGGGTGCGTTCAATC
Atp6ap2	CTAAAGGGGAGGGGCTT	CAGGAGAACGACCAGCA
Atp6v0b	CGCGGTTTAGCTCAGGTC	AGCCCTCTTCCCCACCT
Atp6v0d2	GACCCTCTTCCCCACCT	ACAGCGTCAAACAAAGGC

Figure 2 Aortic gross oil red O staining.

Figure 3 Histological and immunohistochemical characterization of plaques in the aortic sinus. (A) Representative micrographs of oil red O staining, MASSON staining, HE staining and immunofluorescence double staining of CD68 (green particles) and α-SMA (red particles) in frozen sections of aortic sinus of ApoE-/- mice; Objective magnification 4×. (B and C) The plaque area ratio of the aortic sinus stained by oil red O and HE was calculated by Image J. (D and E) Quantification of extracellular matrix and macrophages, using ImageJ to calculate the percentage of positive area to total plaque area. (*p<0.05, ***p<0.001, ****p<0.0001).

Figure 4 Blood Lipids. (A) the levels of TC; (B) the levels of TG; (C) the levels of LDL-C. Due to the effect of WD, the levels of LDL-C, TC, and TG in the AS22W group were significantly higher than those in the other three groups (** p<0.01,****p<0.0001).

Figure 5 Difference analysis. (A) Difference analysis of volcano maps of AS6w and Sham6W groups. (B) Heat maps of top 5 differentially high/low expression genes in AS6w and Sham6W groups. (C) PCA of AS6w group and Sham6W group; (D) Difference analysis volcano maps of AS22w and Sham22W groups. (E) Heat maps of top 5 differentially high/low expression genes in AS22w and Sham22W groups. (F) PCA of AS22w and Sham22W groups.

Figure 6 PPI network construction. (A) PPI networks of DEGs in AS22w and Sham22W groups. (B) Top 9 hub genes based on PPI network.

Figure 7 The expression of Hub genes. (A) Expression of Hub genes in AS6w group and Sham6W group. (B) Expression of Hub genes in AS22w group and Sham22W group. (C) Expression of Hub genes in the GSE100927 dataset of carotid atherosclerotic lesion group and normal carotid artery group (ns p≥0.05;*p< 0.05;***p<0.001).

Figure 8 Construction of related regulatory network. (A) mRNA-TF regulatory network. (B) mRNA-RBP regulatory network. (C) mRNA-Chemical network.

Table 2 GO Enrichment Analysis

Ontology	ID	Description	GeneRatio	BgRatio	pvalue
BP	GO:0050878	Regulation of body fluid levels	5/36	342/23210	1.75e-04
BP	GO:0062012	Regulation of small molecule metabolic process	5/36	359/23210	2.19e-04
BP	GO:0001959	Regulation of cytokine-mediated signaling pathway	3/36	108/23210	6.26e-04
BP	GO:0034765	Regulation of ion transmembrane transport	5/36	478/23210	8.08e-04
BP	GO:0060759	Regulation of response to cytokine stimulus	3/36	118/23210	8.09e-04
BP	GO:0019233	Sensory perception of pain	3/36	143/23210	0.001
BP	GO:0030574	Collagen catabolic process	2/36	36/23210	0.001
BP	GO:0006953	Acute-phase response	2/36	41/23210	0.002
BP	GO:0019221	Cytokine-mediated signaling pathway	4/36	341/23210	0.002
BP	GO:0042060	Wound healing	4/36	360/23210	0.002
CC	GO:0034703	Cation channel complex	3/37	219/23436	0.005
CC	GO:0031012	Extracellular matrix	4/37	475/23436	0.006
CC	GO:0016528	Sarcoplasm	2/37	84/23436	0.008
CC	GO:0070469	Respiratory chain	2/37	89/23436	0.009
CC	GO:0034702	Ion channel complex	3/37	293/23436	0.011
CC	GO:1902495	Transmembrane transporter complex	3/37	308/23436	0.013
CC	GO:1990351	Transporter complex	3/37	315/23436	0.013
CC	GO:0099056	Integral component of presynaptic membrane	2/37	116/23436	0.014
CC	GO:0046581	Intercellular canaliculus	1/37	10/23436	0.016
CC	GO:0098889	Intrinsic component of presynaptic membrane	2/37	128/23436	0.017
MF	GO:0005518	Collagen binding	3/37	69/22710	1.94e-04
MF	GO:0097110	Scaffold protein binding	3/37	71/22710	2.11e-04
MF	GO:0004129	Cytochrome-c oxidase activity	2/37	23/22710	6.40e-04
MF	GO:0015002	Heme-copper terminal oxidase activity	2/37	23/22710	6.40e-04
MF	GO:0015078	Proton transmembrane transporter activity	3/37	120/22710	9.81e-04
MF	GO:0004175	Endopeptidase activity	4/37	443/22710	0.006
MF	GO:0043177	Organic acid binding	3/37	223/22710	0.006
MF	GO:0009055	Electron transfer activity	2/37	70/22710	0.006
MF	GO:0048306	Calcium-dependent protein binding	2/37	71/22710	0.006
MF	GO:0048018	Receptor ligand activity	4/37	489/22710	0.008

Table 3 GSEA Enrichment Analysis

ID	SetSize	Enrichment Score	NES	pvalue
KEGG_FATTY_ACID_METABOLISM	26	0.889064489	2.628303928	0.001858736
KEGG_PEROXISOME	46	0.761991925	2.52751734	0.001798561
WP_AMINO_ACID_METABOLISM	70	0.677915375	2.432946612	0.001748252
KEGG_PPAR_SIGNALING_PATHWAY	46	0.697787014	2.314550482	0.001798561
WP_FERROPTOSIS	33	0.688805385	2.126204898	0.001883239
KEGG_TRYPTOPHAN_METABOLISM	28	0.702382131	2.101550832	0.001845018
KEGG_PROTEASOME	33	0.640510195	1.977127273	0.001883239
PID_INTEGRIN2_PATHWAY	19	0.684905047	1.885522412	0.001883239

Table 4 KEGG Signaling Pathway

Ontology	ID	Description	GeneRatio	BgRatio	pvalue	p.adjust	qvalue
KEGG	mmu05020	Prion disease	5/20	268/8910	2.54e-04	2.54e-04	0.019
KEGG	mmu04260	Cardiac muscle contraction	3/20	87/8910	9.09e-04	9.09e-04	0.027
KEGG	mmu05010	Alzheimer disease	5/20	369/8910	0.001	0.001	0.027
KEGG	mmu00190	Oxidative phosphorylation	3/20	133/8910	0.003	0.003	0.049
KEGG	mmu05022	Pathways of neurodegeneration - multiple diseases	5/20	473/8910	0.003	0.003	0.049
KEGG	mmu05014	Amyotrophic lateral sclerosis	4/20	370/8910	0.008	0.008	0.104
KEGG	mmu05012	Parkinson disease	3/20	248/8910	0.017	0.017	0.183

Figure 9 GO and KEGG enrichment analysis of DEGs. (A–C) GO analysis based on differential genes of AS22W group and Sham22W group. ((A) Biological Process. (B) Cellular Component. (C) Molecular Function). (D) KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment analysis based on differential genes of AS22W group and Sham22W group.

Figure 10 GSEA analysis. (A) KEGG FATTY ACID METABOLISM. (B) KEGG PEROXISOME. (C) WP AMINO ACID METABOLISM. (D) KEGG PPAR SIGNALING PATHWAY. (E) WP FERROPTOSIS. (F) KEGG TRYPTOPHAN METABOLISM. (G) KEGG PROTEASOME. (H) PID INTEGRIN2 PATHWAY.

Table 5 GSVA Enrichment Analysis

ID	logFC	AveExpr	P.Value
HALLMARK_OXIDATIVE_PHOSPHORYLATION	0.846350484	−0.022428455	7.28E-05
HALLMARK_PI3K_AKT_MTOR_SIGNALING	0.474118883	−0.025197612	0.001955191
HALLMARK_GLYCOLYSIS	0.456788872	−0.025349754	0.002137457
HALLMARK_PEROXISOME	0.465062452	−0.026593604	0.002435273
HALLMARK_ADIPOGENESIS	0.518663177	−0.024545602	0.003282311
HALLMARK_MTORC1_SIGNALING	0.488651631	0.018552476	0.004703929
HALLMARK_FATTY_ACID_METABOLISM	0.547938294	−0.002870537	0.005111172
HALLMARK_REACTIVE_OXIGEN_SPECIES_PATHWAY	0.468565163	−0.070735596	0.00783507
HALLMARK_KRAS_SIGNALING_UP	0.304330666	−0.053337609	0.044821921
HALLMARK_XENOBIOTIC_METABOLISM	0.304832634	−0.048130807	0.048088733

Figure 11 GSVA Enrichment analysis. (A and B) Enrichment pathway in AS22w group and Sham22W difference analysis box map and heat map (ns p≥0.05, *p< 0.05, **p<0.01, *** p<0.001).

Figure 12 Immunoassay. (A) Abundance of immune cells in AS22w and Sham22W samples. (B) Heat map of correlation between Hub genes and levels of immune cell infiltration (*p< 0.05).

Figure 13 (A and B) Gene expression of Atp6v0d2, Atp6v1a in aorta of mice in each group (**p<0.01, ***p<0.001, ****p<0.0001). (C) The proportion of positive area of co-localization of CD68 and Atp6v0d2 by immunofluorescence double staining of aortic sinus (****p<0.0001). (D) Representative immunofluorescence analysis for detecting the colocalization (yellow particles) of CD68 (specific for monocyte macrophages, green particles) and Atp6v0d2 (red particles) in frozen sections from the aortic sinus of ApoE^−/− mice; red arrow: the co-localization of CD68 and Atp6v0d2; Objective magnification 4×, 18×.