miR-370 mimic inhibits replication of Japanese encephalitis virus in glioblastoma cells

Figures & data

Table 1 Primers for real-time PCR

Gene	GenBank accession no	Primer (5′-3′)	Length	Tm	Location
TRAF3	NM_001139490	For: TCACGGAGGTGATTAGAATGACT	23	60.6	116-138
		Rev: ACAACCACGTCTATGGCCTTT	21	61.7	242-222
IRF3	NM_001197128	For: AGAGGCTCGTGATGGTCAAG	20	61.3	260-279
		Rev: AGGTCCACAGTATTCTCCAGG	21	60.3	359-339
IFN-β	NM_002176	For: ATGACCAACAAGTGTCTCCTCC	22	61.6	1-22
		Rev: GGAATCCAAGCAAGTTGTAGCTC	23	61.4	88-66
NF-κB	NM_003998	For: AACAGAGAGGATTTCGTTTCCG	22	60.3	155-176
		Rev: TTTGACCTGAGGGTAAGACTTCT	23	60.4	258-236
GAPDH	NM_014364	For: TGTGGGCATCAATGGATTTGG	21	60.9	231-251
		Rev: ACACCATGTATTCCGGGTCAAT	22	61.4	346-325

Note: “For” and “Rev” represent forward and reverse primers, respectively.

Abbreviations: PCR, polymerase chain reaction; TRAF3, tumor necrosis factor receptor-associated factor 3; IRF3, interferon regulatory factor-3; IFN-β, interferon-β; NF-κB, nuclear factor-kappa B; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; Tm, melting temperature.

Figure 1 Effects of JEV on miRNA expressions in U251 cells.

Note: *P<0.05 and **P<0.01 compared with control.
Abbreviations: JEV, Japanese encephalitis virus; miRNA, microRNA; mRNA, messenger RNA; Ctrl, control.

Table 2 Expression profile of miRNAs in U251 after JEV infection

ProbeSet Name	Fold change (B1 A1)	Regulation (B1 A1)	Median CV (%)	Dyes
miR-21-5p	4.2312	Up	3.69	Cy3
miR-150-5p	3.1104	Up	6.79	Cy3
miR-342-3p	2.6396	Up	7.15	Cy3
miR-663a	3.2143	Up	6.18	Cy3
miR-3614-5p	2.0065	Up	8.02	Cy3
miR-296-3p	4.1056	Up	6.81	Cy3
miR-664b-5p	3.3315	Up	7.03	Cy3
miR-335-3p	3.4125	Up	6.76	Cy3
miR-155-5p	2.6617	Up	6.88	Cy3
miR-887	3.9711	Up	6.18	Cy3
miR-3656	2.8991	Up	8.41	Cy3
miR-221-5p	4.0061	Up	9.25	Cy3
miR-642a-3p	0.4002	Down	6.87	Cy3
miR-370-5p	0.2902	Down	8.04	Cy3
miR-191-3p	0.3415	Down	7.07	Cy3
miR-145-3p	0.3189	Down	5.78	Cy3
miR-1	0.2587	Down	6.81	Cy3
miR-let-7	0.3815	Down	5.79	Cy3
miR-270-3p	0.1987	Down	5.97	Cy3
miR-114-3p	0.3612	Down	5.74	Cy3
miR-199a-3p	0.2986	Down	5.84	Cy3
miR-128	0.3476	Down	5.25	Cy3
miR-656	0.3628	Down	7.15	Cy3
miR-410	0.2284	Down	7.86	Cy3
miR-4485	0.3481	Down	5.84	Cy3
miR-217	0.2468	Down	6.83	Cy3
miR-484	0.1967	Down	6.01	Cy3
miR-25-3p	0.3861	Down	4.91	Cy3
miR-127-3p	0.2853	Down	2.05	Cy3

Notes: A1, JEV group; B1, control group.

Abbreviations: miRNAs, microRNAs; JEV, Japanese encephalitis virus; CV, coefficient of variation.

Figure 2 miR-370 mimic inhibition of JEV replication (A), endogenous miR-370 expression (B), JEV-induced apoptosis (C), and proliferation-inhibition (D).

Note: *P<0.05 and **P<0.01 compared with control inhibitor/mimic.
Abbreviations: JEV, Japanese encephalitis virus; mRNA, messenger RNA; miRNA, microRNA; Ctrl, control; OD, optical density; CCK-8, Cell Counting Kit-8; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling.

Figure 3 Effects of miR-370 mimic on the expression of innate immunity-related genes.

Notes: (A) JEV increased IFN-β and NF-κB expression, (B) TRAF3, (C) IRF3, (D) IFN-β, and (E) NF-κB. *P<0.01 and **P<0.05 compared with control mimic/control.
Abbreviations: JEV, Japanese encephalitis virus; IFN-β, interferon-β; NF-κB, nuclear factor-kappa B; TRAF3, tumor necrosis factor receptor-associated factor 3; IRF3, interferon regulatory factor-3; mRNA, messenger RNA; Ctrl, control; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.