The interactive effects of ketamine and ethanol on dopamine expression in the ventral tegmental area of rats

Figures & data

Table 1 Animal models

Group	Morning	Afternoon
Control	Saline	Saline
E30	20% ethanol 2 mL/kg	Saline
K30	Ketamine 30 mg/kg	Saline
K60	Ketamine 60 mg/kg	Saline
K30+E	Ketamine 30 mg/kg + 20% ethanol 2 mL/kg	Saline
K60+E	Ketamine 60 mg/kg + 20% ethanol 2 mL/kg	Saline

Table 2 Primers for qRT-PCR analysis

Gene	Primer sequence (5′-3′)
	Forward	Reverse
TH	CGGGCTATGTAAACAGAATGG	CACAGGCTGGTAGGTTTGATC
DDC	CCTACTGGCTGCTCGGACTA	TTTCTACGGAGGAATGTGCC
VMAT2	GGATGGTGGACTCCTCTATGAT	CTCCTTAGCAGGTGGACTTCG
SNAP25	TGGAGGAGATGCAGAGGAGG	CAATGCGTTCCAGTTGTTCG
GAPDH	ACAGCAACAGGGTGGTGGAC	TTTGAGGGTGCAGCGAACTT

Abbreviations: DDC, dopa decarboxylase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; qRT-PCR, quantitative real-time polymerase chain reaction; SNAP25, synaptosomal-associated protein 25; TH, tyrosine hydroxylase; VMAT2, vesicular monoamine transporter 2.

Figure 1 DA concentrations in the VTA of rats treated with saline (Ctrl), 20% ethanol (E), 30 mg/kg ketamine (K30), 60 mg/kg ketamine (K60), 30 mg/kg ketamine with 20% ethanol (K30+E), and 60 mg/kg ketamine with 20% ethanol (K60+E).

Notes: A p-value of <0.05 was considered significant. **p < 0.005, *p < 0.05 compared to the saline control (ctrl). Data were presented as mean ± SEM, N = 6 per group.
Abbreviations: SEM, standard error of the mean; VTA, ventral tegmental area; DA, dopamine.

Figure 2 The gene expression levels of TH, DDC, VMAT2, and SNAP25 in the rat’s VTA of three independent brain samples in groups of the saline (Ctrl), 20% ethanol (E), 30 mg/kg ketamine (K30), 60 mg/kg ketamine (K60), 30 mg/kg ketamine with 20% ethanol (K30+E), and 60 mg/kg ketamine with 20% ethanol (K60+E) with three technical replicates of each sample.

Notes: A p-value of <0.05 was considered significant. ***p < 0.0005, **p < 0.005. Data were presented as mean ± SEM, N = 3 per group.
Abbreviations: DDC, dopa decarboxylase; SEM, standard error of the mean; SNAP25, synaptosomal-associated protein 25; TH, tyrosine hydroxylase; VMAT2, vesicular monoamine transporter 2; VTA, ventral tegmental area.

Figure 3 BDNF protein expression in the rat’s VTA treated with the saline (Ctrl), 20% ethanol (E), 30 mg/kg ketamine (K30), 60 mg/kg ketamine (K60), 30 mg/kg ketamine with 20% ethanol (K30+E), and 60 mg/kg ketamine with 20% ethanol (K60+E).

Notes: Histograms represent mean ± SEM of densitometry, N = 4. Representative Western blot images were shown. A p-value of <0.05 was considered significant. **p < 0.005 compared to the saline control (Ctrl). Data were presented as mean ± SEM, N = 4 per group.
Abbreviations: BDNF, brain-derived neurotrophic factor; SEM, standard error of the mean; VTA, ventral tegmental area.

Figure 4 (A) TH immunostaining of section from the rat’s VTA treated with the saline (Control), 20% ethanol (Ethanol), 30 mg/kg ketamine (K30), 60 mg/kg ketamine (K60), 30 mg/kg ketamine with 20% ethanol (K30+E), and 60 mg/kg ketamine with 20% ethanol (K60+E), N = 3 per group, TH positive neurons (brown, arrows) were found in the VTA as shown, 200×. (B) AOD of immunohistochemical staining of TH calculated by Image Pro Plus 6.0 software. *Indicates p<0.05 compared to the saline control.

Abbreviations: AOD, average optical density; TH, tyrosine hydroxylase; VTA, ventral tegmental area.