Simvastatin pretreatment ameliorates t-PA–induced hemorrhage transformation and MMP-9/TIMP-1 imbalance in thromboembolic cerebral ischemic rats

Figures & data

Table 1 The forward and reverse primers used

RNA	Forward primer	Reverse primer
MMP-9	AGCCGGGAACGTATCTGGA	TGGAAACTCACACGCCAGAAG
TIMP-1	CGAGACCACCTTATACCAGCGTTA	TGATGTGCAAATTTCCGTTCC
β-actin	GGAGATTACTGCCCTGGCTCCTA	GACTCATCGTACTCCTGCTTGCTG

Table 2 Physiological and biochemical indicators

	Normal (n=6)^a	Simvastatin (n=6)^b	Water (n=6)^b
Systolic BP (mmHg)	127.6±15.6	130.5±12.3	129.3±16.5
Diastolic BP (mmHg)	82.7±14.9	84.1±13.8	84.6±14.7
Body weight (g)	307.6±10.3	334.4±15.2	332.1±13.7
TG (mmol/L)	0.45±0.084	0.33±0.075^c	0.47±0.102
T-cho (mmol/L)	1.78±0.31	1.70±0.39	1.83±0.35
HDL-cho (mmol/L)	0.73±0.45	0.67±0.37	0.76±0.42
LDL-cho (mmol/L)	0.14±0.061	0.12±0.083	0.16±0.077

Notes: ^aThe normal value of these measures were detected from six randomly selected rats before simvastatin or water treatment. ^bThe measures were performed just before surgery. ^cp<0.05 versus water group.

Figure 1 Simvastatin ameliorates t-PA-induced blood MMP-9/TIMP-1 ratio imbalance. Rats were pretreated with SIM (60 mg/kg/d) for the SIM+ group or water for the SIM- group for two weeks, then rats were received t-PA (10 mg/kg) for the t-PA+ group or normal saline for the t-PA- group 3 hrs after operation. Blood samples were collected via abdominal aorta puncture before sacrificed. (A) ELISA analysis of MMP-9 and TIMP-1 protein expression. (B) Real-time PCR analysis of MMP-9 and TIMP-1 mRNA levels. (C) The blood MMP-9/TIMP-1 protein ratio. (D) The blood MMP-9/TIMP-1 mRNA ratio. Bars express the mean ± SD of duplicates (n=6). **p<0.01 t-PA alone versus t-PA plus SIM; &&p<0.01 t-PA alone versus t-PA-/SIM-; ##p<0.01 versus sham group.

Abbreviation: SIM, simvastatin.

Figure 2 Simvastatin ameliorates t-PA-induced brain MMP-9/TIMP-1 ratio imbalance. Rats were pretreated with SIM (60 mg/kg/d) for the SIM+ group or water for the SIM- group for two weeks, then rats were received t-PA (10 mg/kg) for the t-PA+ group or normal saline for the t-PA- group 3 hrs after operation. (A) Representative images of gel electrophoresis results. (B) Quantitative analysis of MMP-9 level. (C) Quantitative analysis of TIMP-1 level. The normalized band intensity was calculated according to the formula: (MMP-9 or TIMP-1/β-actin)_I/(MMP-9 or TIMP-1/β-actin)_C. Bars express the mean±SD of duplicates (n=6). (D) The result of brain MMP-9/TIMP-1 protein ratio. Bars express the mean±SD of duplicates (n=6). **p<0.01 t-PA alone versus t-PA plus SIM; &p<0.05, &&p<0.01 t-PA alone versus t-PA-/SIM-; ##p<0.01 versus sham group.

Abbreviations: I, infarct hemisphere; C, contralateral hemisphere; SIM, simvastatin.

Figure 3 Pretreatment with simvastatin ameliorates t-PA-induced hemorrhage transformation in cerebral ischemic stroke without a significant change in neurological outcome in rats. (A) The result of mNSS tests. The mNSS tests were performed just before sacrificed (n=12/group). (B) The simvastatin-pretreated group showed lower intracranial hemorrhage than that of the t-PA thrombolysis-alone group. **p<0.01 t-PA alone versus t-PA plus SIM; &p<0.05, &&p<0.01 t-PA alone versus t-PA-/SIM. Abbreviation: mNSS, modified neurological severity score.

Figure 4 Simvastatin regulates the t-PA-induced RhoA activity and the t-PA-induced MMP-9/TIMP-1 imbalance and hemorrhage are ameliorated by Y27632. (A) Representative images of Rho pull-down assay. (B) Quantitative analysis of RhoA activity. The result is normalized as the formula: (active RhoA/total RhoA)_I/(active RhoA/total RhoA)_C. Rats were received t-PA (10 mg/kg) plus Y27632 (1 mg/kg or 10 mg/kg) or DMSO. (C) The t-PA-induced MMP-9/TIMP-1 imbalance is ameliorated by Y27632 with different concentrations. (D) The t-PA-induced hemorrhage is ameliorated by Y27632 with different concentrations. **p<0.01 t-PA alone versus t-PA plus SIM; &&p<0.01 t-PA alone versus t-PA-/SIM-; #p<0.05, ###p<0.001 versus t-PA alone.

Abbreviations: I, infarct hemisphere; C, contralateral hemisphere; SIM, simvastatin.