Orexin/Hypocretin Type 2 Receptor (HCRTR2) Gene as a Candidate Gene in Sertraline-Associated Insomnia in Depressed Patients

Figures & data

Table 1 Primer Sequences and G1246A Polymorphism Properties

Polymorphism	Primer Sequence (5ʹ–3ʹ)	Restriction Enzyme	Genotypes	DNA Fragment Size (bp)
G1246A (rs2653349)	5- CCTTTCAGATCCCTGGAACA −3 (sense) 5- CAAATTGCAAATACCAAAAGCA −3 (anti-sense)	MboI	GG GA AA	120, 60 120, 60, 40 120,40

Table 2 Clinical and Demographic Characteristics of the Study Samples

Variable	No Insomnia (N=46)	Insomnia (N=50)	P-value
Sex (male/female)	19/27	20/30	0.531
Age (years) mean±SD	40.5±12.6	40.2±12.7	0.907

Table 3 ISI Scores of Enrolled Patients at Baseline (Week 0) and Week 4 of Treatment with Sertraline

	ISI Week 0	ISI Week 4	P-value
Sertraline-induced Insomnia (N=50)	5.06±1.99	16.96±2.12	0.0001
No insomnia (N=46)	6.80±1.77	6.20±1.69	0.0998

Notes: ISI (Insomnia Severity Index) scores in week 0 and week 4 of treatment with sertraline.

Table 4 Genotype and Allele Distribution of G1246A Variant in Study Groups

Polymorphism	Variant	No Insomnia (N=46)	Insomnia (N=50)	Pc	OR	95% CI
rs2653349				0.022	2.5	1.1–5.7
	GG	19 (41.3%)	32 (64.0%)
	GA	24 (52.2%)	17 (34.0%)
	AA	3 (6.5%)	1 (2.0%)
Alleles				0.022	2.1	1.1–4.0
	G	62 (67.4%)	81 (81.0%)
	A	30 (32.6%)	19 (19.0%)

Abbreviations: Pc, P-value for χ² test; OR, odds ratio; CI, confidence interval.

Table 5 Genotype and Allele Distribution of G1246A Variant in Female and Male Patients

Polymorphism	Variant	No Insomnia	Insomnia	Pc	OR	95% CI
rs2653349 Female (N=57)				0.011	4.0	1.3–12.0
	GG	9 (33.3%)	20 (66.7%)
	GA	17 (63.0%)	9 (30.0%)
	AA	1 (3.7%)	1 (3.3%)
Alleles				0.033	2.4	1.02–5.7
	G	35 (64.8%)	49 (81.7%)
	A	19 (35.2%)	11 (18.3%)
rs2653349 Male (N=39)				0.444	1.3	0.4–4.8
	GG	10 (52.6%)	12 (60.0%)
	GA	7 (36.9%)	8 (40.0%)
	AA	2 (10.5%)	0 (0.0%)
Alleles				0.25	1.6	0.6–4.6
	G	27 (71.1%)	32 (80.0%)
	A	11 (28.9%)	8 (20.0%)

Abbreviations: Pc, P-value for χ² test; OR, odds ratio; CI, confidence interval.