Gastrodin Attenuates Tourette Syndrome by Regulating EAATs and NMDA Receptors in the Striatum of Rats

Figures & data

Figure 1 A schematic representation of the experimental procedures (TS model and treatments procedure in rats).

Table 1 Primer Sequences Used for the qRT-PCR Analysis

Gene	Sequences (5′-3′)
EAAT1	Forward	GCCATCATGAGATTGGTAGCGGT
	Reverse	GGAAGTAGAGGAGAGGCAGGACGA
EAAT2	Forward	GAACTTCGGTCAATGTAGTGGGCG
	Reverse	TGGACTGCGTCTTGGTCATTTCG
NMDAR1	Forward	CGGTATCAGGAATGCGACTC
	Reverse	GGAAAATCCCAGCTACGATG
NMDAR2A	Forward	GCTTGTGGTGATCGTGCTGAA
	Reverse	AATGCTGAGGTGGTTGTCATCTG
NMDAR2B	Forward	TGGCTATCCTGCAGCTGTTTG
	Reverse	TGGCTGCTCATCACCTCATTC
GAPDH	Forward	TTCCTACCCCCAATGTATCCG
	Reverse	CCACCCTGTTGCTGTAGCCATA

Figure 2 Effects of Gas treatment on stereotypy score of rats with TS induced by IDPN.

Notes: Stereotypy score was measured as described in materials and methods. Each bar represented the mean ± SD (n=15). ^##p<0.01 vs control group; **p<0.01 vs TS group.

Figure 3 Effects of Gas treatment on nodding numbers of rats with TS induced by IDPN.

Notes: Numbers of nods were measured as described in materials and methods. Each bar represented the mean ± SD (n=15). ^##p< 0.01 vs control group; **p< 0.01 vs TS group.

Figure 4 Effects of Gas treatment on autonomic activity of rats with TS induced by IDPN.

Notes: (A) Representative movement trajectory of each group of rats. (B) The number of times to enter the central area of each group of rats. (C) The central region residence time of each group of rats. (D) The autonomic total distance of each group of rats. The movement trajectory, number of times to enter the central area, central region residence time and autonomic total distance were detected as described in materials and methods. Each bar represented the mean ± SD (n=15). ^##p<0.01 vs control group; *p< 0.05, **p< 0.01 vs TS group.

Figure 5 Effects of Gas treatment on Glu level in the striatum of the rats with TS induced by IDPN.

Notes: (A) Representative extracted chromatograms of Glu. (B) The Glu level of each group of rats. Glu level was measured as described in materials and methods. Each bar represented the mean ± SD (n=4). ^##p<0.01 vs control group; **p<0.01 vs TS group.

Figure 6 Effects of Gas treatment on the protein expression of EAAT1, EAAT2, NMDAR1, NMDAR2A and NMDAR2B in the striatum of the rats with TS induced by IDPN.

Notes: (A) Representative protein bands of EAAT1, EAAT2, NMDAR1, NMDAR2A and NMDAR2B of each group of rats in the striatum. (B) The protein expression of EAAT1 in the striatum detected by Western blot. (C) The protein expression of EAAT2 in the striatum detected by Western blot. (D) The protein expression of NMDAR1 in the striatum detected by Western blot. (E) The protein expression of NMDAR2A in the striatum detected by Western blot. (F) The protein expression of NMDAR2B in the striatum detected by Western blot. The levels of these proteins were measured as described in materials and methods. Each bar represented the mean ± SD. ^##p< 0.01 vs control group; **p<0.01 vs TS group.

Figure 7 Effects of Gas treatment on the mRNA expression of EAAT1, EAAT2, NMDAR1, NMDAR2A and NMDAR2B in the striatum of the rats with TS induced by IDPN.

Notes: (A) The mRNA expression of EAAT1 in the striatum detected by qRT-PCR. (B) The mRNA expression of EAAT2 in the striatum detected by qRT-PCR. (C) The mRNA expression of NMDAR1 in the striatum detected by qRT-PCR. (D) The mRNA expression of NMDAR2A in the striatum detected by qRT-PCR. (E) The mRNA expression of NMDAR2B in the striatum detected by qRT-PCR. The expressions of these mRNAs were measured as described in materials and methods. Each bar represented the mean ± SD. ^##p<0.01 vs control group; *p<0.05, **p< 0.01 vs TS group.

Figure 8 A schematic illustration of the proposed mechanism by which Gas alleviates Tourette syndrome in rats.

Notes: The red arrows indicate the possible mechanism of Gas. Gas might maintain the concentration of extracellular Glu at a suitable level by upregulating the expression of EAAT1 and EAAT2 to increase the clearance of Glu. The decreased Glu level might inhibit over-activation of NMDAR1, NMDAR2A and NMDAR2B and depress glutamatergic neurotransmission and brain excitability.

Abbreviations: Glu, glutamate; Gln, glutamine; EAAT1, Glutamate aspartate transporter (GLAST); EAAT2, Glial glutamate transporter (GLT-1); NMDARs, N-methyl-d-aspartate receptors; VGLUTs, vesicular glutamate transporters; GS, Glutamine Synthetase; PAG, phosphate activated glutaminase.