Sleep and Methylation of Estrogen Receptor Genes, ESR1 and GPER, in Healthy Middle-Aged and Older Women: Findings from the Women 40+ Healthy Aging Study

Figures & data

Table 1 Descriptive Statistics

N	All	PRE	PERI	POST
	130	51	16	63
Sleep problems (mean/SD)	4.8/2.5	4.2/2.4	5.8/2.6	5/2.5
VMS (mean/SD)	1.8/1	1.3/0.5	2.4/1.1	2/1.2
ESR1 methylation (%; mean/SD)	76.7/12	79/8.4	78.1/7.9	74.5/14.7
GPER methylation (%; mean/DS)	15.3/7	14.8/1.8	19.2/3.8	14.8/1.8
Age (mean/range)	53.2/40-73	45.1/40-57	51.4/47-56	60.2/50-73
BMI (kg/m^2; mean/SD)	23/3.6	22.8/3.9	21.5/3.4	23.7/3.3
E2 (nmol/L; mean/SD)	5.6/4.5	8.2/4.7	5.7/4.5	3.7/3.2
Depressive symptoms (mean/SD)	8.3/5.9	7.4/5.5	10.1/7.3	8.6/5.7
Caffeine (cups/day; mean/SD)	2.5/2	2.2/0.2	2.1/0.4	2.7/0.1

Note: The percentages of ESR1 and GPER methylation correspond to the mean of methylation percentages of the 9 CpGs and 22 CpGs assessed in the ESR1 and GPER sequences, respectively.

Abbreviations: PRE, premenopausal, PERI, perimenopausal, POST, postmenopausal, VMS, vasomotor symptoms, ESR1, estrogen receptor 1 gene, GPER, G protein-coupled estrogen receptor gene, BMI, body mass index, E2, estradiol, SD, standard deviation.

Figure 1 Schematic figures of ESR1 (A) and GPER (B) promoter regions. (A) The DNA sequence of ESR1, chr6: 151805523–151805822, is located in a CpG island shore of promoter C, and it has been described as an enhancer (ID GH06J151804) of promoter A.⁴⁴ This region has been reported in humans and rats by Champagne et al, 2006,²³ Gardini et al, 2020,³⁵ Ianov et al, 2017,⁴⁶ and Tsuboi et al, 2017.⁴⁴ (B) The DNA sequence of GPER, chr7:1087059–1087533 is located in a CpG island across exons 1 and 2. This region has been assessed in Weissenborn et al, 2017.⁴⁵ White boxes represent exons or promoter regions. Underlined sequences correspond to the primers position. Bold “CG” correspond to the Interrogated CpGs.

Table 2 PCR Primers Used for Amplification of DNA Sequences in the ESR1 and GPER

Gene	Forward Primer	Reverse Primer	GRCh38	Ta (°C)
ESR1	ACACTGACGACATGGTTCTACA NNN GTTTTTTGTGAGTAGATAGTAAGTT	TACGGTAGCAGAGACTTGGTCT NNN AAACCTACCCTACTAAATCAAAAAC	chr6:151805523–151805822	58
GPER	ACACTGACGACATGGTTCTACA NNNAGTGAAAATTTAAATGGTTAGTA	TACGGTAGCAGAGACTTGGTCT NNNACAATCCAAACAATTCAAAATTTATTT	chr7:1087059–1087533	60

Note: Universal primer CS1= ACACTGACGACATGGTTCTACA, universal primer CS2= TACGGTAGCAGAGACTTGGTCT.

Abbreviations: PCR, polymerase chain reaction; ESR1, estrogen receptor alpha gene; GPER, G protein-coupled estrogen receptor gene; GRCh38, Genome Reference Consortium Human Build 38 Organism; Ta, annealing temperature.

Figure 2 Path diagram (Macro Model 4) according to Hayes (2017).⁶²

Figure 3 Path diagram of the mediation model (Macro Model 4),⁶² illustrating the associations between ESR1 methylation (X) and sleep disturbances (Y) through VMS (M_i). Estradiol (E2), menopausal status (MS), depressive symptoms, body mass index (BMI), age and caffeine consumption were included in the model and controlled in each of the three paths (a_i, b_i, c’). Values outside parentheses= unstandardized b coefficient; values in parentheses= standard error; *= p-value < 0.05; **= p-value < 0.01.

Abbreviations: ESR1-m, estrogen receptor 1 methylation; VMS, vasomotor symptoms.

Table 3 Results of the Mediation Model with ESR1 Methylation as Predictor, 95% Bias-Corrected Confidence Interval Predicting Sleep Quality

Outcome Variable: VMS	b	se	t	p	LLCI	ULCI
ESR1-m (ai)	0.0175	0.0078	2.2550	0.0261	0.0021	0.0329
CV
Age	−.0516	0.0169	−3.0573	0.0028	−.0850	−.0182
MS	0.7049	0.1640	4.2969	0.0000	0.3798	1.0300
BMI	0.0194	0.0149	1.2970	0.1974	−.0102	0.0490
E2	−.0018	0.0224	−.0790	0.9372	−.0462	0.0427
Depressive symptoms	−.0151	0.0155	−.9704	0.3340	−.0458	0.0157
Caffeine	0.0201	0.0575	0.3502	0.7269	−.0938	0.1340
Outcome variable: sleep problems (PSQI)
VMS (bi)	0.6301	0.2112	2.9837	0.0035	0.2116	1.0487
CV
Age	0.0586	0.0389	1.5055	0.1351	−.0186	0.1358
MS	−.3619	0.3927	−.9215	0.3588	−1.1401	0.4164
BMI	0.0178	0.0333	0.5331	0.5950	−.0483	0.0838
E2	0.0147	0.0497	0.2962	0.7676	−.0838	0.1132
Depressive symptoms	0.2033	0.0345	5.8904	0.0000	0.1349	0.2717
Caffeine	−.2224	0.1274	−1.7456	0.0837	−.4748	0.0301
Direct/indirect effects on sleep problems (PSQI)
Direct effect (c’)	0.0249	0.0176	1.4159	0.1597	−.0100	0.0597
Indirect effect (aixbi)	0.0110	0.0073			0.0013	0.0299

Notes: a_i represents the association between ESR1-m and VMS; b_i represents the association between VMS and sleep quality; c’ represents the direct effect of ESR1-m on Y, after adjusting for all other variables included in the model; a_ixb_i represents the indirect effect of ESR1-m on sleep quality through VMS; b represents the unstandardized regression coefficient.

Abbreviations: se, standard error, BootLLCI, bootstrapping lower limit confidence interval; BootULCI, bootstrapping upper limit confidence interval; VMS, vasomotor symptoms, ESR1-m, estrogen receptor alpha gene methylation; CV, control variables; MS, menopausal status; BMI, body mass index; E2, estradiol.

Figure 4 Path diagram of the mediation model (Macro Model 4),⁶² illustrating the associations between GPER methylation (X) and sleep disturbances (Y) through VMS (M_i). Estradiol (E2), menopausal status (MS), depressive symptoms, body mass index (BMI), age and caffeine consumption were included in the model and controlled in each of the three paths (a_i, b_i, c’). Values outside parentheses= unstandardized b coefficient; values in parentheses= standard error.

Abbreviations: GPER-m, G protein-coupled estrogen receptor methylation; VMS, vasomotor symptoms.

Table 4 Results of the Mediation Model with GPER Methylation as Predictor, 95% Bias-Corrected Confidence Interval Predicting Sleep Quality

Outcome Variable: VMS	b	se	t	p	LLCI	ULCI
GPER-m (ai)	−.0396	0.0262	−1.5117	0.1437	−.0937	0.0145
CV
Age	−.0749	0.0353	−2.1208	0.0445	−.1477	−.0020
MS	0.7074	0.3276	2.1596	0.0410	0.0313	1.3836
BMI	−.0210	0.0245	−.8555	0.4007	−.0716	0.0296
E2	−.0478	0.0414	−1.1542	0.2598	−.1332	0.0376
Depressive symptoms	−.0228	0.0304	−.7485	0.4614	−.0856	0.0400
Caffeine	0.2073	0.1481	1.3999	0.1743	−.0983	0.5129
Outcome variable: sleep problems (PSQI)
VMS (bi)	0.9248	0.5017	1.8434	0.0782	−.1131	1.9627
CV
Age	0.1699	0.0945	1.7971	0.0855	−.0257	0.3655
MS	−1.2543	0.8799	−1.4256	0.1674	−3.0746	0.5659
BMI	−.0036	0.0612	−.0594	0.9531	−.1302	0.1229
E2	0.0183	0.1045	0.1751	0.8625	0.1978	0.2344
Depressive symptoms	0.2018	0.0756	2.6686	0.0137	0.0454	0.3583
Caffeine	−.6193	0.3785	−1.6360	0.1155	−1.4023	0.1638
Direct/indirect effects on sleep problems (PSQI)
Direct effect (c’)	0.0730	0.0674	1.0834	0.2899	−.0664	0.2124
Indirect effect (aixbi)	−.0366	0.0367			−.1083	0.0416

Notes: a_i represents the association between GPER-m and VMS; b_i represents the association between VMS and sleep quality; c’ represents the direct effect of GPER-m on Y, after adjusting for all other variables included in the model; a_ixb_i represents the indirect effect of GPER-m on sleep quality through VMS; b represents the unstandardized regression coefficient.

Abbreviations: se, standard error, BootLLCI, bootstrapping lower limit confidence interval; BootULCI, bootstrapping upper limit confidence interval; VMS, vasomotor symptoms, GPER-m, G protein-coupled estrogen receptor gene methylation; CV, control variables; MS, menopausal status; BMI, body mass index; E2, estradiol.

Tsuboi K, Nagatomo T, Gohno T, et al. Single CpG site methylation controls estrogen receptor gene transcription and correlates with hormone therapy resistance. J Steroid Biochem Mol Biol. 2017;171:209–217. doi:10.1016/j.jsbmb.2017.04.001

 Web of Science ®Google Scholar

Champagne FA, Weaver ICG, Diorio J, Dymov S, Szyf M, Meaney MJ. Maternal care associated with methylation of the estrogen receptor-α1b promoter and estrogen receptor-α expression in the medial preoptic area of female offspring. Endocrinology. 2006;147(6):2909–2915. doi:10.1210/en.2005-1119

 PubMed Web of Science ®Google Scholar

Gardini ES, Chen GG, Fiacco S, et al. Differential ESR1 promoter methylation in the peripheral blood—findings from the women 40+ healthy aging study. Int J Mol Sci. 2020;21(10):3654. doi:10.3390/ijms21103654

 Web of Science ®Google Scholar

Ianov L, Kumar A, Foster TC. Epigenetic regulation of estrogen receptor α contributes to age-related differences in transcription across the hippocampal regions CA1 and CA3. Neurobiol Aging. 2017;49:79–85. doi:10.1016/j.neurobiolaging.2016.09.013

 Web of Science ®Google Scholar

Weissenborn C, Ignatov T, Nass N, et al. GPER Promoter Methylation Controls GPER Expression in Breast Cancer Patients. Cancer Invest. 2017;35(2):100–107. doi:10.1080/07357907.2016.1271886

 PubMed Web of Science ®Google Scholar

Hayes AF. Introduction to Mediation, Moderation, and Conditional Process Analysis, Second Edition: A Regression-Based Approach. Guilford Publications; 2017. https://books.google.ch/books?id=8ZM6DwAAQBAJ.

 Google Scholar