Nampt/PBEF/visfatin serum levels: a new biomarker for retinal blood vessel occlusions

Figures & data

Table 1 Patient demographics (18 eyes of 18 patients)

Characteristic	N	%
Age (years)
<40	0	0
40–49	2	11.1
50–59	8	44.4
60–69	6	33.3
≥70	2	11.1
Sex
Male	7	38.9
Female	11	61.1
Study eye
OD	11	61.1
OS	7	38.9
Clinical manifestation
HRVO	3	16.7
BRVO	7	38.9
CRVO	5	27.8
CRAO	3	16.7
Treatment
Anti-VEGF	11	61.1
Laser (focal or PRP)	11	61.1
Anti-VEGF + laser	7	38.9
PBEF gene polymorphisms
T1001G	0	0
C1535T	0	0

Notes: Patient demographics are summarized. A total of 18 subjects (mean age: 59.1±2.1 years) with RVO were enrolled in the study. We tested for two PBEF1 gene polymorphisms, T1001G and C1535T, based on the study by Ye et al.¹⁹ None of the subjects carried a SNP allele.

Abbreviations: BRVO, branch retinal vein occlusion; CRAO, central retinal artery occlusion; CRVO, central retinal vein occlusion; HRVO, hemiretinal vein occlusion; Nampt, nicotinamide phosphoribosyltransferase; OD, right eye; OS, left eye; PBEF, pre-B-cell colony-enhancing factor; PRP, pan-retinal photocoagulation; RVO, retinal vascular occlusion; SNP, single-nucleotide polymorphism; VEGF, vascular endothelial growth factor.

Table 2 Clinical parameters of subjects with RVOs

ID	Age	Sex	Race	BMI	Event	Eye	Anti-VEGF y/n	Laser, y/n	BSCVA (initial)	BSCVA (final)	logMAR (initial)	logMAR (final)	Δ log MAR	Nampt (ng/mL)
1	57	Male	Black	34	HRVO	OS	Yes	Yes	20/CF	20/200	2	1	1	0.155
2	56	Male	White	39	BRVO	OD	No	Yes	20/200	20/200	1	1	0	0.54
3	62	Female	Black	38	CRVO	OD	No	Yes	20/CF	20/200	2	1	1	0.099
4	67	Female	Black	31	BRVO	OD	Yes	Yes	20/400	20/30	1.3	0.2	1.1	0.086
5	54	Male	Black	26	CRVO	OS	Yes	Yes	20/CF	20/100	2	0.7	1.3	0.291
6	46	Male	White	30	CRVO	OD	Yes	Yes	20/400	20/CF	1.3	2	−0.7	0.094
7	52	Male	White	28	BRVO	OS	Yes	No	20/50	20/50	0.4	0.4	0	0.104
8	62	Male	White	41	BRVO	OD	Yes	Yes	20/300	20/60	1.2	0.5	0.7	0.874
9	63	Female	Black	44	BRVO	OD	Yes	Yes	20/25	20/30	0.1	0.2	−0.1	0.064
10	50	Female	White	32	HRVO	OS	Yes	Yes	20/300	20/80	1.2	0.6	0.6	0.101
11	61	Female	Black	46	CRVO	OD	Yes	No	20/CF	20/300	2	1.2	0.8	0.079
12	49	Female	Black	22	HRVO	OD	Yes	No	20/CF	20/400	2	1.3	0.7	0.183
13	83	Female	Black	40	CRAO	OD	No	Yes	HM	NLP	3	a	a	0.252
14	59	Male	Black	29	CRVO	OD	No	No	HM	HM	3	3	0	0.103
15	66	Female	Black	51	CRAO	OD	No	No	20/25	20/20	0.1	0	0.1	0.224
16	54	Female	Black	41	BRVO	OS	No	No	20/30	20/20	0.2	0	0.2	0.178
17	53	Female	Black	62	CRVO	OD	Yes	No	20/400	20/200	1.3	1	0.3	0.145
18	70	Female	Black	45	BRVO	OS	No	Yes	20/200	20/40	1	0.3	0.7	0.099

Notes: Relevant clinical parameters describing manifestation, intervention, and visual acuity for subjects with RVO. The concentration of serum Nampt is provided for each subject.

a Light perception is not an actual visual acuity measurement and can therefore not be converted to a numerical logMAR score.³¹

Abbreviations: BMI, body mass index; BRVO, branch retinal vein occlusion; BSCVA, best spectacle-corrected visual acuity; CF, counting fingers; CRAO, central retinal artery occlusion; CRVO, central retinal vein occlusion; HM, hand motion; HRVO, hemiretinal vein occlusion; logMAR, logarithm of the minimum angle of resolution; Nampt, nicotinamide phosphoribosyltransferase; NLP, no light perception; OD, right eye; OS, left eye; PRP, pan-retinal photocoagulation; RVO, retinal vascular occlusion; SNP, single-nucleotide polymorphism; VEGF, vascular endothelial growth factor; y/n, yes/no.

Figure 1 Serum Nampt levels are lower in subjects with RVOs.

Notes: (A) Standard curve for serum Nampt levels obtained using a commercially available ELISA kit. The R² value indicated the goodness of fit after fifth-parameter nonlinear fit regression. (B) Serum Nampt levels are lower in subjects with RVOs compared with healthy volunteers (n=6 controls, n=18 subjects with RVO; unpaired t-test: P<0.05). (C) There is no statistically significant difference in serum Nampt levels among different types of RVOs. Bars represent mean ± SEM. *P<0.05, **P<0.01, ***P<0.001.
Abbreviations: A₄₅₀, absorbance at 450 nm; BRVO, branch retinal vein occlusion; CRAO, central retinal artery occlusion; CRVO, central retinal vein occlusion; ELISA, enzyme-linked immunosorbent assay; HRVO, hemiretinal vein occlusion; Nampt, nicotinamide phosphoribosyltransferase; RVO, retinal vascular occlusion; SEM, standard error of the mean.

Table 3 SNP determination

Type	Sequence (5′→3′)	Label (5′/3′)
SNP: T1001G
Probe (T)	TTCTAACACATAATTGAGGTCTTTCT	6FAM/BHQ1
Probe (G)	TTCTAACACATAAGTGAGGTCTTTCT	HEX/BHQ1
Sense primer	AGGACATAAAGATCATAGC	None
Antisense primer	CACTGAGTTTGGGATATC	None
SNP: C1535T
Probe (T)	TCCCTCATTTCTTCTGCTCTAGC	6FAM/BHQ1
Probe (G)	TCCCTCATTTCCTCTGCTCTAGC	HEX/BHQ1
Sense primer	CCCTGACCTCATCTTCTA	None
Antisense primer	TCACGTACTCCAGGATAG	None

Notes: Molecular beacons and primers used for SNP genotyping are listed. Molecular beacons were labeled with 6FAM or HEX to allow separation of the signal for each variant. Sequences were designed based on the PBEF1 sequence in GenBank accession number AC007032.2, as described in Ye et al.¹⁹

Abbreviations: 6FAM, 6-carboxyfluorescein; BHQ, Black Hole Quencher 1; HEX, hexachloro-6-carboxyfluorescein; SNP, single-nucleotide polymorphism.

Figure 2 Serum Nampt levels do not correlate with visual acuity or SD-OCT findings.

Notes: (A) Serum Nampt levels in patients with a history of retinal blood vessel occlusions did not correlate with improvement of visual acuity after clinical intervention, expressed as the improvement in logMAR scores (R²=0.006). (B–D) Furthermore, there was no statistically significant correlation between serum Nampt levels and retinal thickness, as determined by SD-OCT. Correlations are shown for serum Nampt levels with retinal thickness on the outer and inner circles, as well as the center retinal thickness measurement.
Abbreviations: logMAR, logarithm of the minimum angle of resolution; Nampt, nicotinamide phosphoribosyltransferase; SD-OCT, spectral-domain optical coherence tomography.

Figure 3 Serum Nampt levels do not correlate with age or BMI.

Notes: (A) We tested for an association between serum Nampt levels and age by calculating a Pearson product–moment correlation coefficient. The solid line represents the line of best fit (R²=0.006), while the dotted lines represent the 95% confidence interval. There was no statistically significant association between serum Nampt levels and age (P=0.75). (B) Similarly, we did not identify a statistically significant association between serum Nampt levels and BMI (R²=0.007; P=0.75).
Abbreviations: BMI, body mass index; Nampt, nicotinamide phosphoribosyltransferase.

YeSQSimonBAMaloneyJPPre-B-cell colony-enhancing factor as a potential novel biomarker in acute lung injuryAm J Respir Crit Care Med2005171436137015579727

 PubMed Web of Science ®Google Scholar

HolladayJTProper method for calculating average visual acuityJ Refract Surg19971343883919268940

 PubMed Web of Science ®Google Scholar

KeanePASaddaSRRetinal vein occlusion and macular edema – critical evaluation of the clinical value of ranibizumabClin Ophthalmol2011577178121750610

 PubMedGoogle Scholar