The clinical significance of γ-catenin in acute myeloid leukemia

Figures & data

Table 1 Three types of shRNA plasmids

Target site	Target sequence of shRNA
JUP-home-1307	GCTGAAGATTCTGGTGAATCA
JUP-home-855	GTCCTGTTCTATGCCATCACC
JUP-homo-1553	CGCTGTGCGTCTCAACTATGG

Abbreviation: shRNA, short hairpin RNA.

Figure 1 γ-Catenin expression and clinical characteristics.

Notes: (A) The level of γ-catenin gene compared between the 71 AML patients and the 16 healthy controls. (B) The level of γ-catenin gene compared between patients with AML-M2 and the others. (C) The expression level of γ-catenin gene in patients with lower WBC (<30×10⁹/L) and patients with higher WBC (≥30×10⁹/L). (D) The expression level of γ-catenin gene in patients with mutated CEBPα gene in contrast with patients with nonmutated CEBPα gene.
Abbreviations: AML, acute myeloid leukemia; mRNA, messenger RNA; WBC, white blood cells.

Table 2 Patient characteristics

Characteristic	Value	P-valuea
Age, years (median, range)	47 (13–85)	0.945
<60, n (%)	50 (70.4)
≥60, n (%)	21 (29.6)
Sex, n (%)		0.066
Male	40 (56.3)
Female	31 (43.7)
WBC at diagnosis, ×10^9/L (median, range)	20.8 (0.7–299.7)	0.032
<30, n (%)	39 (56.5)
≥30, n (%)	30 (43.5)
Missing data, n	2
Hemoglobin at diagnosis, g/L (median, range)	81.0 (11.0–159.0)	0.111
Normal (male 120–160, female	11 (17.7)
110–150), n (%)
Anemia (male <120, female <110), n (%)	51 (82.3)
Missing data, n	9
Platelet at diagnosis, ×10^9/L (median, range)	40.0 (2.0–279.0)	0.284
Normal (100–300), n (%)	9 (14.3)
Thrombocytopenia (<100), n (%)	54 (85.7)
Missing data, n	8
BM blasts at diagnosis, % (median, range)	73.6 (20.4–99.0)
French American British subtype, n (%)		0.292
M0	2 (2.8)
M1	17 (23.9)
M2	26 (36.6)
M3	9 (12.7)
M4	3 (4.2)
M5	8 (11.3)
M6	5 (7.0)
Unclassified	1 (1.4)
FLT3-ITD mutation status, mutated +/total (%)	5/56 (8.9)	0.605
NPM1 mutation status, mutated +/total (%)	11/52 (21.2)	0.831
CEBPα mutation status, mutated +/total (%)	13/46 (28.3)	0.047
Cytogenetics, n (%)		0.114
Favorable	13 (21.0)
Intermediate	44 (70.9)
Unfavorable	5 (8.1)
Missing data, n	9
Extramedullary presentation, n (%)		0.286
Yes	19 (26.8)
No	52 (73.2)

Notes:

a γ-Catenin mRNA levels were compared among different groups. Mann–Whitney U-test was employed to evaluate quantitative parameters, and χ² test was used for qualitative parameters. Statistical analyses were performed using Student’s t-test. All reported P-values were two-sided.

Abbreviations: WBC, white blood cells; BM, bone marrow.

Figure 2 γ-Catenin expression and clinical characteristics.

Notes: Correlation between γ-catenin expression and other clinical characteristics including age (A), sex (B), cytogenetics (C and D), extramedullary presentation (lymphadenectasis and/or hepatosplenomegaly) (E), mutation status of NPM1 (F) and FLT3-ITD (G), and fusion genes AML1-ETO (H) in AML.
Abbreviations: AML, acute myeloid leukemia; mRNA, messenger RNA.

Figure 3 The expression level of γ-catenin gene compared between patients (n=38) who achieved CR following one to two cycles of standard induction chemotherapy and those who could not achieve CR after two cycles of induction chemotherapy (n=18).

Abbreviation: CR, complete remission.

Figure 4 γ-Catenin expression and OS and RFS in AML.

Notes: (A and B) Correlations between γ-catenin expression levels and OS and RFS in AML patients. (C and D) Correlations between γ-catenin expression levels and OS and RFS in subgroups with intermediated-risk cytogenetics. (E and F) Correlations between γ-catenin expression levels and OS and RFS in subgroups who were younger than 60 years and with intermediated-risk cytogenetics.
Abbreviations: OS, overall survival; RFS, relapse-free survival; AML, acute myeloid leukemia.

Figure 5 γ-Catenin protein level in K562 and THP-1 cell line and the process of transfection in K562.

Notes: (A) The expression level of γ-catenin protein was determined by Western blot in K562 cell line and THP-1 cell line. (B) The transfection efficiency was determined posttransfection at 24, 48, and 72 hours by fluorescent microscopy (×10). (C) shRNA was transfected into K562 cell line to suppress the expression of γ-catenin protein.
Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; KD, knockdown; h, hours; NC, negative control; shRNA, short hairpin RNA.

Figure 6 The cell viability and ability of migration.

Notes: (A) The cell viability of K562 cell compared between K562/KD and K562/NC after the suppression of γ-catenin protein expression. (B) The ability of migration of K562 cell line after the suppression of γ-catenin protein expression.
Abbreviations: KD, knockdown; NC, negative control; WT, wild type.

Figure 7 The effect of decitabine.

Notes: (A) The sensitivity of K562 cell line to decitabine therapy after the suppression of γ-catenin protein expression. (B) The cell viability of K562 cell line after treatment separately with 1) growth media, 2) decitabine, 3) zVAD (20 µM) + decitabine, and 4) Nec-1 (30 µM) + decitabine.
Abbreviations: KD, knockdown; Nec-1, Necrostatin-1; NC, negative control; WT, wild type; zVAD, Benzyloxycarbonyl-Val-Ala-Asp.