Correlations of microvascular blood flow of contrast-enhanced ultrasound and HGF/c-Met signaling pathway with clinicopathological features and prognosis of patients with hepatocellular carcinoma

Figures & data

Table 1 Clinicopathological features of 118 patients with hepatocellular carcinoma

Feature	Case number
Gender (male/female)	75/43
Smoking history (yes/no)	68/50
Alcohol history (yes/no)	79/39
Tumor differentiation (high/moderate/low differentiation)	46/41/31
TMN stage (I/II/III/IV)	20/21/36/41
Tumor size (<3 cm/≥3 cm)	56/62
Tumor number (<3/≥3)	53/65
Vascular invasion (yes/no)	67/51
Lymphatic invasion (yes/no)	71/47
Liver cirrhosis (yes/no)	75/43
AFP (<20/≥20 ng/mL)	35/83
HBsAg/HCV (negative/positive)	87/31
HBV-DNA (negative/positive)	42/76

Abbreviations: TNM, tumor, node, and metastasis; AFP, alpha-fetoprotein; HBsAg/HCV, hepatitis B surface antigen/hepatitis C virus; HBV-DNA, hepatitis B virus-DNA.

Table 2 The primers for quantitative real-time polymerase chase reaction

Gene	Primer sequence (5′–3′)
HGF	Forward: GAATGACACTGATGTTCCTTTGG
	Reverse: GGATACTGAGAATCCCAACGC
c-Met	Forward: GCAGGTTGTGGTTTCTCG
	Reverse: TGCAGCCCAAGCCATTCA
β-Actin	Forward: CGGGAAATCGTGCGTGAC
	Reverse: AGGCAGCTCGTAGCTCTTCT

Figure 1 The protein and mRNA expressions of HGF and c-Met expressions in the HCC and adjacent normal tissues (×200). (A) The protein expressions of HGF and c-Met in HCC and adjacent normal tissues; (B) the HGF mRNA expressions in HCC and adjacent normal tissues; (C) the c-Met mRNA expressions in HCC and adjacent normal tissues; *P<0.05 compared with the adjacent normal tissues.

Abbreviations: HGF, hepatocyte growth factor; c-Met, cellular mesenchymal to epithelial transition factor; HCC, hepatocellular carcinoma.

Figure 2 Comparison of microvessel density in the HCC and adjacent normal tissues. (A) The CD34 expression in HCC tissues and adjacent normal tissues (×400); (B) Comparison of MVD in the HCC and adjacent normal tissues; **P<0.01 compared with the adjacent normal tissues.

Abbreviations: MVD, micro-vessel density; HCC, hepatocellular carcinoma.

Table 3 Comparisons of quantitative parameters of CEUS between liver parenchyma and HCC lesions

Tissues	Time to peak (s)	Peak intensity (dB)	Area under the curve (dB^*s)	Washout time (s)
HCC lesions	21.81±5.13#	58.70±10.10#	1,162.50±141.20#	32.60±6.40#
Liver parenchyma	30.22±7.51	43.20±8.50	572.80±41.70	67.34±11.16

Note:

# P<0.05 compared with the adjacent normal tissues.

Abbreviations: CEUS, contrast-enhanced ultrasound; HCC, hepatocellular carcinoma.

Table 4 Correlations of HGF and c-Met protein expressions and MVD with clinicopathological features of HCC patients

Feature	HGF expression (%)	P-value	c-Met expression (%)	P-value	MVD	P-value
Age (years)		0.938		0.367		0.888
<50	32.65		69.39		47.49±7.13
≥50	33.33		76.81		47.71±9.09
Gender		0.192		0.573		0.185
Male	37.33		72.00		48.39±8.42
Female	25.58		76.74		46.28±8.00
Tumor differentiation		0.352		0.239		0.592
Low	22.58		70.97		48.94±9.40
Moderate	36.59		82.93		47.19±7.12
High	36.96		67.39		47.12±8.57
TNM stage		0.025		0.006		0.02
I + II	46.34		58.54		45.19±8.62
III + IV	25.97		81.82		48.91±7.88
Tumor size		0.003		0.027		0.002
<3 cm	46.43		64.29		45.20±8.80
≥3 cm	20.97		82.26		49.81±7.21
Tumor number		0.56		0.219		0.273
<3	35.85		79.25		46.69±7.71
≥3	30.77		69.23		48.38±8.74
Vascular invasion		0.042		0.005		0.002
Yes	25.37		83.58		49.66±7.14
No	43.14		60.78		44.94±9.01
Liver cirrhosis		0.025		0.042		0.157
Yes	25.33
No	46.51
HCV infection		0.026		0.046		0.780
Positive	16.13		48.39		47.51±8.82
Negative	39.08		27.59		47.94±6.76
HBV infection		0.015		0.024		0.596
Positive	25.00		40.79		47.92±8.15
Negative	47.62		19.0		47.07±8.63

Abbreviations: HGF, hepatocyte growth factor; c-Met, cellular mesenchymal to epithelial transition factor; HCC, hepatocellular carcinoma; TNM, tumor, node, and metastasis; MVD, microvessel density; HCV, hepatitis C virus; HBV, hepatitis B virus.

Table 5 Correlations of quantitative parameters of CEUS with clinicopathological features of HCC patients

Feature	Time to peak (s)	Peak intensity (dB)	Area under the curve (dB^*s)	Washout time (s)
Age (years)
<50	21.71±6.23	58.81±10.94	576.18±38.77	68.33±11.68
≥50	21.88±4.23	58.62±9.54	570.40±43.78	66.63±10.81
Gender
Male	22.04±5.50	58.74±9.65	573.53±43.25	66.40±11.10
Female	21.41±4.45	58.62±10.95	571.52±39.32	68.98±11.22
Tumor differentiation
Low	21.69±4.82	59.42±9.17	572.88±44.60	66.73±12.76
Medium	21.94±4.89	57.38±10.45	569.88±39.48	67.17±10.19
High	21.78±5.63	59.39±10.47	575.35±42.37	67.90±11.07
TNM stage
I + II	25.18±4.75	56.73±11.11	576.65±44.77	66.68±12.56
III + IV	20.02±4.39#	59.75±9.42	570.75±40.12	67.69±10.41
Tumor size
<3 cm	23.36±6.04	55.02±10.84	563.39±45.97	70.71±11.18
≥3 cm	20.41±3.65#	62.03±8.13#	583.21±33.84#	63.60±9.97#
Tumor number
<3	23.30±4.22	54.76±9.83	561.50±39.94	69.93±10.88
≥3	20.60±5.50#	61.92±9.20#	586.65±39.92#	64.15±10.76#
Vascular invasion
Yes	20.41±5.27	62.87±9.82	595.61±37.39	63.57±12.24
No	23.65±4.34#	53.22±7.58#	555.44±36.27#	70.21±9.38#
HGF expression
Positive	23.18±6.22	54.00±8.49	567.35±40.86	68.90±10.68
Negative	21.14±4.38#	61.02±10.07#	583.84±41.71#	64.17±11.58#
c-Met expression
Positive	20.67±4.44	60.41±9.97	591.74±37.66	65.30±12.03
Negative	25.01±5.63#	53.89±8.98#	566.05±41.18#	68.06±10.82#
MVD
High	20.04±3.73	62.38±9.60	584.62±40.13	65.36±12.13
Low	23.58±5.72#	55.02±9.28#	560.98±40.16#	69.31±9.82#

Note:

# P<0.05 of comparison within group.

Abbreviations: HGF, hepatocyte growth factor; c-Met, cellular mesenchymal to epithelial transition factor; TNM, tumor, node, and metastasis; MVD, microvessel density.

Table 6 Univariate survival analysis of risk factors for the prognosis of HCC patients

Factor	1-year DFS rate (%)	3-year DFS rate (%)	5-year DFS rate (%)
Age (years)
<50	71.43	59.18	40.82
≥50	72.46	56.52	37.68
Gender
Male	76.00	60.00	41.33
Female	65.12	53.49	34.88
Tumor differentiation
Low	51.61#	32.26#	12.90#
Medium	63.41#	53.66#	34.15#
High	93.48	78.26	60.87
TNM stage
I + II	92.68	92.68	68.29
III + IV	61.04#	38.96#	23.38#
Tumor size
<3 cm	94.64	73.21	53.57
≥3 cm	51.61#	43.55#	25.81#
Tumor number
<3	83.02	71.70	56.60
≥3	63.08#	46.15#	24.62#
Vascular invasion
Yes	61.19	41.79	25.37
No	86.27#	78.43#	56.86#
HGF expression
Positive	87.18	79.49	66.67
Negative	64.56#	46.84#	25.32#
c-Met expression
Positive	66.67	50.57	33.33
Negative	87.10#	77.42#	54.84#
MVD
High	52.54	32.20	16.95
Low	91.53#	83.05#	61.02#
Time to peak
Short	61.02	44.07	23.73
Long	83.05#	71.19#	54.24#
Peak intensity
Strong	61.02	44.07	23.73
Weak	83.05#	71.19#	54.24#
Area under the curve
Small	83.05	71.19	54.24
Large	61.02#	44.07#	23.73#
Washout time
Long	83.05	71.19	54.24
Short	61.02#	44.07#	23.73#

Note:

# P<0.05 of comparison within group.

Abbreviations: DFS, disease-free survival; TNM, tumor, node, and metastasis; HGF, hepatocyte growth factor; c-Met, cellular mesenchymal to epithelial transition factor; MVD, microvessel density.

Table 7 Multivariate survival analysis with Cox’s proportional hazards model of risk factors for the prognosis of HCC patients

Factor	Risk	95% CI	Regression coefficient	P-value
Tumor differentiation	0.219	0.143–0.335	−1.521	<0.001
TNM stage	40.668	14.671–112.735	3.705	<0.001
Tumor size	5.701	2.701–12.036	1.741	<0.001
Tumor number	2.938	1.594–5.416	1.078	0.001
Vascular invasion	2.731	1.436–5.195	1.005	0.002
HGF expression	0.448	0.220–0.916	−0.802	0.028
c-Met expression	4.164	1.562–11.098	1.427	0.004
MVD	1.032	1.000–1.065	0.031	0.049
Time to peak	1.094	0.985–1.214	0.09	0.093
Peak intensity	1.048	1.001–1.098	0.047	0.044
Area under the curve	0.989	0.977–1.001	−0.011	0.084
Washout time	0.964	0.926–1.003	−0.037	0.073

Abbreviations: TNM, tumor, node, and metastasis; HGF, hepatocyte growth factor; c-Met, cellular mesenchymal to epithelial transition factor; MVD, microvessel density; CI, confidence interval.

Figure 3 Effects of c-Met inhibitor on the growth of transplanted tumors in nude mice. (A) The growth of transplanted tumors in nude mice of three groups; (B) comparison of weights of transplanted tumors in nude mice of three groups; *P<0.05 compared with blank group.

Abbreviation: c-Met, cellular-mesenchymal to epithelial transition factor.

Figure 4 Effects of c-Met inhibitor on MVD of transplanted tumors in nude mice. (A) The MVD of transplanted tumors in nude mice of the experimental group, ×400; (B) the MVD of transplanted tumors in nude mice of the negative control group, ×400; (C) the MVD of transplanted tumors in nude mice of the blank group, ×400; (D) comparison of MVD among three groups; *P<0.05 compared with blank group.

Abbreviations: c-Met, cellular-mesenchymal to epithelial transition factor; MVD, microvessel density.

Figure 5 Comparisons of quantitative parameters of CEUS of transplanted tumors in nude mice among three groups. *P<0.05 compared with blank group.

Abbreviations: AUC, area under the curve; CEUS, contrast-enhanced ultrasound; PI, peak intensity; TTP, time to peak; WOT, washout time.