Epithelial-to-mesenchymal transition correlates with gefitinib resistance in NSCLC cells and the liver X receptor ligand GW3965 reverses gefitinib resistance through inhibition of vimentin

Figures & data

Table 1 Primer sequences for amplification of the genes encoding β-actin and vimentin

Primer name	Primer sequence 5′ to 3′
β-actin-F	AGCACTGTGTTGGCGTACAG
β-actin-R	GGACTTCGAGCAAGAGATGG
VIM-F	AGTCCACTGAGTACCGGAGAC
VIM-R	CATTTCACGCATCTGGCGTTC

Abbreviation: VIM, vimentin.

Table 2 Gefitinib IC₅₀ values of H1975, H1299, H358, HCC827, HCC827/GR-8-1, HCC827/GR-8-2, and HCC827/GR-8-12 cell lines

Cell line	Gefitinib sensitivity	IC50 value (μmol/L)
H1975	Insensitive	263.49±15.11
H1299	Insensitive	26.28±2.25
H358	Relatively sensitive	5.04±0.57
HCC827	Sensitive	(72.32±1.98) ×10^−3
HCC827/GR-8-1	Insensitive	30.5175±0.19
HCC827/GR-8-2	Insensitive	34.324±1.36
HCC827/GR-8-12	Insensitive	39.99±1.94

Figure 1 Morphologic differences of NSCLC cell lines.

Notes: (A) Cells were seeded onto cell culture dishes and photographed under a light microscope (400×). The resistant cell lines, H1975, H1299, HCC827/GR-8-1, HCC827/GR-8-2, and HCC827/GR-8-12, were found to exhibit morphologic changes, relative to sensitive (HCC827) and moderately sensitive (H358) cell lines, that were consistent with EMT. GR cells displayed typical features of mesenchymal cells, including loss of tight cell adherence, altered polarity, various degrees of shrinkage, blebbing, aggregation, and lack of obvious boundaries. In contrast, sensitive HCC827 and moderately sensitive H358 cells exhibited tight cell adherence. (B) Transwell assays demonstrating that GR cells exhibit higher migration capacity. The data demonstrate that cells with acquired gefitinib resistance (HCC827/GR-8-1, HCC827/GR-8-2, and HCC827/GR-8-12) exhibit higher migration capacity than their parental cell line (HCC827). Moderately sensitive H358 cells also exhibited weak migration ability (200×).
Abbreviations: EMT, epithelial-to-mesenchymal transition; GR, gefitinib-resistant; NSCLC, non-small cell lung cancer.

Figure 2 Among the genes analyzed, nine of those differentially expressed are known to influence EMT.

Notes: (A) Marked upregulation of VIM mRNA (encoding vimentin, which is associated with EMT) was observed in HCC827/GR-8-1 cells. (B) Quantitative RT-PCR analysis demonstrating that the expression levels of VIM were upregulated in cells with intrinsic gefitinib resistance (H1975 and H1299) (****P<0.0001) and in those with acquired gefitinib resistance (HCC827/GR-8-1, HCC827/GR-8-2, and HCC827/GR-8-12) (*P<0.05; **P<0.01; ***P<0.001). (C) Vimentin protein was upregulated in GR cells (H1975, H1299) and in those with acquired gefitinib resistance (HCC827/GR-8-1, HCC827/GR-8-2, and HCC827/GR-8-12). (D) Immunohistochemistry demonstrated a marked increase of the mesenchymal marker, vimentin, in H1299, H1975, H358, HCC827, and HCC827/GRs cells (200×).
Abbreviations: EMT, epithelial-to-mesenchymal transition; GR, gefitinib-resistant; RT-PCR, real-time polymerase chain reaction; VIM, vimentin.

Figure 3 Western blots demonstrating that the GR cell line, HCC827/GR-8-1, demonstrated markedly increased levels of vimentin, and that treatment with gefitinib led to the complete absence of β-catenin protein expression.

Notes: However, after treatment with a combination of GW3965 and gefitinib, the expression level of vimentin was significantly reduced and that of β-catenin clearly increased. GW3965 did not affect the expression of E-cadherin. No changes in EGFR protein levels were observed in cultured cells exposed to 5 µmol/mL gefitinib.
Abbreviations: EGFR, epidermal growth factor receptor; GR, gefitinib-resistant.