A new tumor suppressor lncRNA RP11-190D6.2 inhibits the proliferation, migration, and invasion of epithelial ovarian cancer cells

Figures & data

Table 1 Primers for real time PCR analysis

Gene name	Forward	Reverse
β-actin	5′-CCACTGGCATCGTGATGGA-3′	5′-CGCTCGGTGAGGATCTTCAT-3′
WWOX	5′-CAAGGGCGAGTGAAGCAGT-3′	5′-GGCGGAGGGTGGTATTTTGT-3
RP11-190D6.2	5′-CAGAGTGAGAACCACTGGTGAT-3′	5′-CGAAGGATGAGTTAAAAAGTTT-3′

Abbreviations: PCR, polymerase chain reaction; WWOX, WW domain-containing oxidoreductase.

Table 2 Sequences for small interfering (si) RNA analysis

Gene name	Sense (5′–3′)	Antisense (5′–3′)
RP11-190D6.2-si1	AUGGAUAUUUCCAAGCUGGAACCGA	UCGGUUCCAGCUUGGAAAUAUCCAUGU
RP11-190D6.2-si2	AUUGAAAAUGUAAGAACUAUUCUGA	UCAGAAUAGUUCUUACAUUUUCAAUCA

Figure 1 Relative expression in 33 EOC tissue samples were examined by real-time PCR and normalized to β-actin expression.

Notes: A fold change in tumor tissues relative to normal tissues is depicted. (A) Compared with the matched nontumor tissues, the expression level of RP11-190D6.2 in tumor tissues was evidently decreased (*P<0.05). (B) The expression of RP11-190D6.2 was remarkably downregulated in tumors with higher FIGO stage (III/IV) compared with tumors at lower FIGO stage (I/II) (*P<0.05).
Abbreviations: EOC, epithelial ovarian cancer; FIGO, International Federation of Gynecology and Obstetrics; PCR, polymerase chain reaction.

Figure 2 WWOX mRNA expression level was positively correlated with the RP11-190D6.2 lncRNA overexpression or knockdown in EOC cell lines.

Notes: Real-time PCR was performed to evaluate the expression levels of RP11-190D6.2 and WWOX, aiming to investigate their potential association. (A) The RP11-190D6.2 expression was positively correlated with WWOX expression (R=0.45519, P<0.00777). (B) The expression of RP11-190D6.2 was significantly lower in each EOC cell line compared with HOSE cell line. Additionally, the expression of RP11-190D6.2 was the highest in HEY-A8, but the lowest in H08910-PM. (C) The data showed that the lncRNA RP11-190D6.2 expression significantly increased. Meanwhile, using real-time PCR, we found that the mRNA expression level of WWOX was apparently upregulated by pcDNA RP11-190D62. (D) In RP11-190D6.2 siRNA groups, we found that RP11-190D6.2 expression was evidently decreased, as was WWOX expression. *P<0.05.
Abbreviations: EOC, epithelial ovarian cancer; HOSE, human ovarian surface epithelial; PCR, polymerase chain reaction; WWOX, WW domain-containing oxidoreductase; pcDNA control, pcDNA, plasmid complementary DNA; lncRNA, long noncoding RNA; mRNA, messenger RNA; siRNA, small interfering RNA; NC, negative control.

Figure 3 Influence of DNA demethylating agent (5-aza-dC) on RP11-190D6.2 expression.

Notes: The results suggested that RP11-190D6.2 expression was significantly higher in HEY-A8 and H08910-PM cells exposed to 5-aza-dC than that in NC group (*P<0.05).
Abbreviations: 5-aza-dC, 5-aza-2′-deoxycytidine; NC, negative control; siRNA, small interfering RNA.

Figure 4 Cell proliferative, migratory, and invasive properties were repressed by pcDNA-RP11-190D6.2 in H08910-PM cells.

Notes: (A) We found that the growth of cells was not evident in pcDNA-RP11-190D6.2 group compared with NC group. (B, C) The wound healing assay and matrigel invasion assay revealed that the migration and invasion abilities of cells were remarkably suppressed in pcDNA-RP11-190136.2 group than that in pcDNA control group (*P<0.05). Each image was taken at 40× magnification (objective: 4×, eyepiece: 10×).
Abbreviations: NC, negative control; pcDNA, plasmid complementary DNA; siRNA, small interfering RNA.

Figure 5 Cell proliferation, migration, and invasion were elevated by RP11-190D6.2 siRNA in HEY-A8 cells.

Notes: (A) The growth rate of cells transfected with RP11-190D6.2 siRNA showed great elevation compared with the NC group. (B, C) The scratch wound-healing assay and matrigel invasion assay showed a significant elevation of cell migration and invasion in RP11-190D6.2 siRNA group compared with the NC siRNA group (*P<0.05). Each image was taken at 40× magnification (objective: 4×, eyepiece: 10×).
Abbreviations: NC, negative control; siRNA, small interfering RNA.