Human omental adipose-derived mesenchymal stem cell-conditioned medium alters the proteomic profile of epithelial ovarian cancer cell lines in vitro

Figures & data

Table 1 Primer sequences for qRT-PCR

Gene	Forward primer sequence	Reverse primer sequence
PHB	GTCCTTGACACATCTGACCTTCGGG	CAGCAGAGATGATGGCCGCCT
SRSF1	GGAACAACGATTGCCGCATCTA	CTTGAGGTCGGATGTCGCGGATA
GAPDH	TGCACCACCAACTGCTTAGC	GGCATGGACTGTGGTCATGAG
TBP	TGCACAGGAGCCAAGAGTGAA	CACATCACAGCTCCCCACCA
RPLP0	TTAAACCCTGAGTGGCAATCC	CCACATTCCCCCGGATATGA

Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PHB, prohibitin; qRT-PCR, quantitative real-time polymerase chain reaction; RPLP0, ribosomal protein, large, P0; SRSF1, serine/arginine-rich splicing factor 1; TBP, TATA box binding protein.

Figure 1 Representative two-dimensional electrophoretic images of human epithelial ovarian cancer SKOV3 cells untreated (A) and treated with CM from O-ADSC (B).

Notes: Eleven spots with significant alterations in expression that were subjected to mass spectrometry identification are encircled in white. Among them, spots 1–10 are enlarged and spot 11 becomes smaller after treatment with O-ADSC CM. No magnification.
Abbreviations: CM, conditioned medium; O-ADSC, omental adipose-derived mesenchymal stem cell.

Table 2 Characteristics of differentially expressed protein alterations in SKOV3 cells between treated and untreated groups with O-ADSC CM

Spot number	Accession number	Protein name	Mascot score	MW (Da)	pI	Up/downregulated after treatment with CM	Abbreviation name
1	JAC06007	60 kDa heat shock protein	4,335	61,187	6.73	Upregulated	HSP60
2	P60709	β-Actin	1,871	42,052	5.29	Upregulated	ACTB
3	NP-01193728	Pyruvate kinase isozyme M1/M2	1,421	58,470	7.95	Upregulated	KPYM
4	CAG46507	Prohibitin	1,012	29,843	5.57	Upregulated	PHB
5	NP-008855	Serine/arginine-rich splicing factor 1	501	27,842	10.37	Upregulated	SRSF1
6	No significant hits to report
7	AA14156	Cathepsin D	676	45,037	5.6	Upregulated	CTSD
8 and 9	P04624	Cytokeratin 1	631	66,170	8.15	Upregulated	CK1
10	P30048	Peroxiredoxin 3	436	28,017	5.77	Upregulated	PRDX3
11	NP-001138632	Tropomyosin 4	667	28,619	5.19	Downregulated	TPM4

Abbreviations: CM, conditioned medium; MW, molecular weight; O-ADSC, omental adipose-derived mesenchymal stem cell; pI, isoelectric point.

Table 3 Associated disease and functions of identified proteins

Spot number	Protein name	Associated disease (reference)	Protein function (reference)
1	60 kDa heat shock protein	Colorectal cancer^Citation40 and hepatocellular carcinoma^Citation41	Involved in protein import and correct folding and associated with tumorigenesis^Citation40 and underexpression following treatment with chemotherapeutic agent^Citation41
2	β-Actin	Colorectal neoplasia^Citation42	Always used as denominators of gene expression quantitation, but overexpression in colorectal neoplasia^Citation42
3	Pyruvate kinase isozyme M1/M2	Human malignant melanoma^Citation43	Associated in cell apoptosis^Citation43
4	Prohibitin	Ovarian cancer^Citation18	Stabilization of mitochondrial function,^Citation17,Citation29 inhibits the intrinsic apoptotic pathway,^Citation18 and required for Ras-induced Raf–MEK–ERK activation and epithelial cell migration^Citation16
5	Serine/arginine-rich splicing factor 1	Non-small-cell lung cancer^Citation35 and breast cancer^Citation36	A splicing factor as an oncoprotein,^Citation34 involved in tumor poor prognosis by promoting survivin stability,^Citation35 promotes mammary epithelial cell transformation,^Citation36 and enhances Wnt signaling activation^Citation20
7	Cathepsin D	Pancreatic cancer^Citation44 and human cervical cancer^Citation45	Correlates with malignant progression^Citation44 and antiapoptotic mediator by inducing autophagy^Citation45
8 and 9	Cytokeratin 1	Breast cancer^Citation46 and hepatocellular carcinoma^Citation44	Diagnosis marker^Citation44,Citation47
10	Peroxiredoxin 3	Hepatocellular carcinoma,^Citation48 prostate cancer,^Citation49 breast cancer,^Citation50 and ovarian cancer^Citation51	Involved in chemoresistance^Citation48^–^Citation50 associated with NF-κB signaling pathway^Citation52
11	Tropomyosin 4	Ovarian cancer^Citation53	Diagnosis marker^Citation53

Abbreviations: MEK, mitogen-activated protein/extracellular signal-regulated kinase kinase; ERK, extracellular signal-regulated kinase; NF-κB, nuclear factor-κB.

Figure 2 O-ADSC CM upregulates the mRNA levels of PHB (A–C) and SRSF1 (D–F) in human epithelial ovarian cancer cell lines SKOV3, A2780, and HO-8910.

Notes: The histograms demonstrate the results of qRT-PCR. ^*P<0.05, ^**P<0.01, and ^***P<0.001 compared to control cells that were not treated with O-ADSC CM.
Abbreviations: CM, conditioned medium; O-ADSC, omental adipose-derived mesenchymal stem cell; PHB, prohibitin; qRT-PCR, quantitative real-time polymerase chain reaction; SRSF1, serine/arginine-rich splicing factor 1.

StierumRGaspariMDommelsYProteome analysis reveals novel proteins associated with proliferation and differentiation of the colorectal cancer cell line Caco-2Biochim Biophys Acta200316501–2739112922171

 PubMedGoogle Scholar

ZhangYOwusuLDuanWAnti-metastatic and differential effects on protein expression of epigallocatechin-3-gallate in HCCLM6 hepatocellular carcinoma cellsInt J Mol Med201332495996423863984

 PubMed Web of Science ®Google Scholar

PolleyACMulhollandFPinCProteomic analysis reveals field-wide changes in protein expression in the morphologically normal mucosa of patients with colorectal neoplasiaCancer Res200666136553656216818627

 PubMedGoogle Scholar

NawarakJHuang-LiuRKaoSHProteomics analysis of kojic acid treated A375 human malignant melanoma cellsJ Proteome Res2008793737374618630942

 PubMedGoogle Scholar

WangYLiaoHZhengHCEffect of luteinizing hormone-induced prohibitin and matrix metalloproteinases on ovarian epithelial tumor cell proliferationAm J Cancer Res20155111412425628924

 PubMedGoogle Scholar

Gregory-BassRCOlatinwoMXuWProhibitin silencing reverses stabilization of mitochondrial integrity and chemoresistance in ovarian cancer cells by increasing their sensitivity to apoptosisInt J Cancer200812291923193018183577

 PubMed Web of Science ®Google Scholar

ChenNGLuCCLinYHProteomic approaches to study epigallocatechin gallate-provoked apoptosis of TSGH-8301 human urinary bladder carcinoma cells: roles of AKT and heat shock protein 27-modulated intrinsic apoptotic pathwaysOncol Rep201126493994721743966

 PubMed Web of Science ®Google Scholar

RajalingamKWunderCBrinkmannVProhibitin is required for Ras-induced Raf-MEK-ERK activation and epithelial cell migrationNat Cell Biol20057883784316041367

 PubMedGoogle Scholar

EzpondaTPajaresMJAgorretaJThe oncoprotein SF2/ASF promotes non-small cell lung cancer survival by enhancing survivin expressionClin Cancer Res201016164113412520682707

 PubMedGoogle Scholar

AnczukowORosenbergAZAkermanMThe splicing factor SRSF1 regulates apoptosis and proliferation to promote mammary epithelial cell transformationNat Struct Mol Biol201219222022822245967

 PubMed Web of Science ®Google Scholar

KarniRde StanchinaELoweSWSinhaRMuDKrainerARThe gene encoding the splicing factor SF2/ASF is a proto-oncogeneNat Struct Mol Biol200714318519317310252

 PubMed Web of Science ®Google Scholar

FuYHuangBShiZSRSF1 and SRSF9 RNA binding proteins promote Wnt signalling-mediated tumorigenesis by enhancing beta-catenin biosynthesisEMBO Mol Med20135573775023592547

 PubMedGoogle Scholar

SulpizioSFranceschiniNPiattelliADi SebastianoPInnocentiPSelvaggiFCathepsins and pancreatic cancer: the 2012 updatePancreatology201212539540123127526

 PubMedGoogle Scholar

HahYSNohHSHaJHCathepsin D inhibits oxidative stress-induced cell death via activation of autophagy in cancer cellsCancer Lett2012323220821422542809

 PubMedGoogle Scholar

AttallahAMEl-FarMOmranMMCirculating levels and clinical implications of epithelial membrane antigen and cytokeratin-1 in women with breast cancer: can their ratio improve the results?Tumour Biol20143511107371074525073515

 PubMedGoogle Scholar

PalermoCJoyceJACysteine cathepsin proteases as pharmacological targets in cancerTrends Pharmacol Sci2008291222818037508

 PubMed Web of Science ®Google Scholar

IsmailSMayahWBattiaHEPlasma nuclear factor kappa B and serum peroxiredoxin 3 in early diagnosis of hepatocellular carcinomaAsian Pac J Cancer Prev20151641657166325743848

 PubMedGoogle Scholar

UmmanniRBarretoFVenzSPeroxiredoxins 3 and 4 are overexpressed in prostate cancer tissue and affect the proliferation of prostate cancer cells in vitroJ Proteome Res20121142452246622424448

 PubMed Web of Science ®Google Scholar

McDonaldCMuhlbauerJPerlmutterGTaparraKPhelanSAPeroxiredoxin proteins protect MCF-7 breast cancer cells from doxorubicin-induced toxicityInt J Oncol201445121922624789097

 PubMedGoogle Scholar

KalininaEVBerezovTTShtilAAExpression of peroxiredoxin 1, 2, 3, and 6 genes in cancer cells during drug resistance formationBull Exp Biol Med20121536878881 Article in English, Russian23113308

 PubMedGoogle Scholar

DuanJLangYSongCXiongJWangYYanYsiRNA targeting of PRDX3 enhances cisplatininduced apoptosis in ovarian cancer cells through the suppression of the NFkappaB signaling pathwayMol Med Rep2013751688169423503975

 PubMedGoogle Scholar

BaileyMJShield-ArtinKLOlivaKAyhanMReismanSRiceGEStage-specific analysis of plasma protein profiles in ovarian cancer: Difference in-gel electrophoresis analysis of pooled clinical samplesJ Carcinog2013121023858298

 PubMedGoogle Scholar