Genetic variants and increased risk of meningioma: an updated meta-analysis

Figures & data

Figure 1 Flow diagram of publication search and study screening for the meta-analysis.

Table 1 Characteristics of studies included in the meta-analysis

Study	Year	Country/region	Ethnicity	Gene	SNP	Case	Disease group	Control	Source of controls	HWE, P-value	Genotyping methods	NOS score
						MM/Mm/mm		MM/Mm/mm
Ahn et al^Citation39	2002	South Korea	Asian	MTHFR	rs1801133	16/13/3	Meningioma	91/129/34	PB	0.27	PCR-RFLP	7
Bethke et al^Citation38	2009	Finland	Caucasian	CASP8	rs1045485	60/16/0	Meningioma	65/7/0	PB	0.66	Illumina customized GoldenGate array	7
		Denmark	Caucasian	CASP8	rs1045485	81/20/0		84/23/1	PB	0.67
		UK – South	Caucasian	CASP8	rs1045485	92/21/6		93/24/1	PB	0.68
		UK – North	Caucasian	CASP8	rs1045485	128/37/2		133/29/4	PB	0.13
		Sweden	Caucasian	CASP8	rs1045485	115/27/2		115/27/1	PB	0.67
Bethke et al^Citation37	2008	UK – North	Caucasian	MTHFR	rs1801131	80/73/20	Meningioma	94/64/17	PB	0.22	Illumina GoldenGate array	7
		UK – North	Caucasian	MTHFR	rs1801133	57/98/19		73/78/24	PB	0.66
		UK – North	Caucasian	MTRR	rs1801394	54/83/37		74/78/23	PB	0.73
		UK – North	Caucasian	MTR	rs1805087	113/54/7		106/60/8	PB	0.89
		UK – Southeast	Caucasian	MTHFR	rs1801131	54/59/8		62/48/13	PB	0.42
		UK – Southeast	Caucasian	MTHFR	rs1801133	50/57/14		48/60/15	PB	0.57
		UK – Southeast	Caucasian	MTRR	rs1801394	41/57/23		39/59/25	PB	0.76
		UK – Southeast	Caucasian	MTR	rs1805087	77/39/5		75/42/6	PB	0.97
		Sweden	Caucasian	MTHFR	rs1801131	61/77/11		64/66/19	PB	0.76
		Sweden	Caucasian	MTHFR	rs1801133	64/68/17		82/57/10	PB	0.98
		Sweden	Caucasian	MTRR	rs1801394	39/84/26		53/74/22	PB	0.64
		Sweden	Caucasian	MTR	rs1805087	98/45/6		94/51/4	PB	0.34
		Denmark	Caucasian	MTHFR	rs1801131	44/57/9		53/43/17	PB	0.1
		Denmark	Caucasian	MTHFR	rs1801133	45/55/10		56/45/12	PB	0.52
		Denmark	Caucasian	MTRR	rs1801394	41/47/22		40/55/18	PB	0.90
		Denmark	Caucasian	MTR	rs1805087	73/33/4		70/40/3	PB	0.33
		Finland	Caucasian	MTHFR	rs1801131	38/31/8		37/32/8	PB	0.78
		Finland	Caucasian	MTHFR	rs1801133	46/26/5		47/25/5	PB	0.51
		Finland	Caucasian	MTRR	rs1801394	26/37/14		30/33/14	PB	0.36
		Finland	Caucasian	MTR	rs1805087	50/24/3		56/17/4	PB	0.1
Cacina et al^Citation36	2015	Turkey	Caucasian	CASP8	rs1045485	28/8/3	Meningioma	66/42/6	PB	0.84	PCR-RFLP	7
Cengiz et al^Citation35	2008	Turkey	Caucasian	XRCC1	rs25487	25/41/5	Meningioma	43/41/3	PB	0.07	PCR-RFLP	8
De Roos et al^Citation34	2003	US	Caucasian	GSTM1	Present/null	85b/84c	Meningioma	254b/321c	HB	–	PCR	7
				GSTT1	Present/null	121b/38c		445b/100c	HB	–
Dobbins et al^Citation33	2011	Germany	Caucasian	MLLT10	rs12770228	309/426/123	Meningioma	328/302/74	PB	0.72	a	7
		UK	Caucasian	MLLT10	rs12770228	144/187/73		361/321/76	PB	0.71
		Scandinavia	Caucasian	MLLT10	rs12770228	145/158/47		463/424/91	PB	0.67
Egan et al^Citation32	2015	US	Caucasian	MLLT10	rs12770228	111/111/46	Meningioma	287/267/74	PB	0.33	TaqMan assays	7
Elexpuru-Camiruaga et al^Citation31	1995	UK	Caucasian	GSTM1	Present/null	22b/27c	Meningioma	262b/315c	HB	–	PCR	7
		UK	Caucasian	GSTT1	Present/null	26b/21c		403b/91c	HB	–
Huang et al^Citation30	2012	China	Asian	XRCC1	rs1799782	100/80/25	Meningioma	95/102/21	PB	0.39	Snapshot multiplex	8
		China	Asian	XRCC1	rs1799782	53/24/11	<50 years old	41/51/12	PB	0.52
		China	Asian	XRCC1	rs1799782	47/56/14	≥50 years old	54/51/9	PB	0.52
		China	Asian	XRCC1	rs1799782	27/20/7	Male	29/36/9	PB	0.67
		China	Asian	XRCC1	rs1799782	73/60/18	Female	66/66/12	PB	0.42
Huang et al^Citation29	2015	China	Asian	XRCC1	rs1799782	63/41/20	Skull-base meningioma	95/102/21	PB	0.39	Snapshot multiplex	8
Kafadar et al^Citation28	2006	Turkey	Caucasian	MTHFR	rs1801133	20/12/3	Meningioma	53/38/7	PB	0.96	PCR-RFLP	9
Kiuru et al^Citation27	2008	Mixed	Caucasian	XRCC1	rs1799782	469/50/2	Meningioma	1,377/177/2	PB	0.13	PCR-RFLP	9
		Mixed	Caucasian	XRCC1	rs25487	212/233/74		645/728/176	PB	0.17
Li et al^Citation26	2013	China	Asian	MTHFR	rs1801133	101/147/69	Meningioma	159/129/32	PB	0.44	PCR-RFLP	9
		China	Asian	MTHFR	rs1801131	205/96/16		201/98/21	PB	0.06
Pinarbasi et al^Citation25	2005	Turkey	Caucasian	GSTM1	Present/null	12b/11c	Meningioma	116b/37c	HB	–	PCR	7
		Turkey	Caucasian	GSTT1	Present/null	17b/6c		122b/31c	HB	–
Rajaraman et al^Citation24	2010	US	Caucasian	XRCC1	rs1799782	104/18/0	Meningioma	394/73/1	HB	0.21	TaqMan assay	7
		US	Caucasian	XRCC1	rs25487	56/62/14		205/201/72	HB	0.05
Rajaraman et al^Citation23	2007	US	Caucasian	CASP8	rs1045485	117/38/5	Meningioma	426/118/6	HB	0.87	Medium-throughput TaqMan assay	7
Schwartzbaum et al^Citation22	2007	Mixed	Caucasian	GSTM1	Present/null	68b/108c	Meningioma	193b/237c	PB	–	PCR	8
		Mixed	Caucasian	GSTT1	Present/null	149b/27c		362b/68c	PB	–
Semmler et al^Citation21	2008	Germany	Caucasian	MTHFR	rs1801133	131/133/26	Meningioma	132/135/20	PB	0.06	PCR-RFLP	8
		Germany	Caucasian	MTHFR	rs1801131	116/142/32	Meningioma	132/123/32	PB	0.68
		Germany	Caucasian	MTR	rs1805087	197/81/12	Meningioma	184/92/11	PB	0.91
		Germany	Caucasian	MTHFR	rs1801133	10/7/1	WHO grade III	132/135/20	PB	0.91
		Germany	Caucasian	MTHFR	rs1801131	7/10/1	WHO grade III	132/123/32	PB	0.91
		Germany	Caucasian	MTR	rs1805087	18/0/0	WHO grade III	184/92/11	PB	0.91
Zhang et al^Citation20	2013	China	Asian	MTHFR	rs1801131	184/157/50	WHO grade I	289/245/66	PB	0.2	PCR-RFLP	8
		China	Asian	MTRR	rs1801394	135/176/80	WHO grade I	225/282/93	PB	0.77
		China	Asian	MTHFR	rs1801131	79/67/21	WHO grade II	289/245/66	PB	0.2
		China	Asian	MTRR	rs1801394	59/74/34	WHO grade II	225/282/93	PB	0.77
		China	Asian	MTHFR	rs1801131	20/17/5	WHO grade III	289/245/66	PB	0.2
		China	Asian	MTRR	rs1801394	15/19/8	WHO grade III	225/282/93	PB	0.77

Notes: M, major allele; m, minor allele.

a Illumina Infinium HD human 662 quad or OmniExpress BeadChip, competitive allele-specific KASP chemistry;

b number of samples with GSTM1 or GSTT1 null genotype;

c number of samples with GSTM1 or GSTT1 null/present genotype. ‘–’ indicates not available.

Abbreviations: SNP, single-nucleotide polymorphism; HWE, Hardy–Weinberg Equilibrium; NOS, Newcastle–Ottawa Scale; PB, population-based; PCR-RFLP, polymerase chain reaction–restriction fragment-length polymorphism; HB, hospital-based; WHO, World Health Organization.

Table 2 Genes and SNPs included in the meta-analysis

Gene	Chromosome	SNP	Sequence	Global MAF	Variants	Description
MLLT10	10:21494705	rs12770228	CTTTCGCTTGCGGTTTGCAACCCCT [A/G]GGGTGGGTCTGACCCCGCGCGGCAC	A =0.156/781	C895T	Transcription factor and partner gene involved in several chromosomal rearrangements
CASP8	2:201284866	rs1045485	GCTTCATTTTGAGATCAAGCCCCAC [C/G]ATGACTGCACAGTAGAGCAAATCTA	C =0.0527/264	D302H	Apoptosis-related cysteine peptidase
XRCC1	19:43553422	rs1799782	GAGGCCGGGGGCTCTCTTCTTCAGC [C/T]GGATCAACAAGACATCCCCAGGTGA	A =0.1238/620	R194W	DNA repair of single-strand breaks and base excision
	19:43551574	rs25487	CGCATGCGTCGGCGGCTGCCCTCCC [A/G]GAGGTAAGGCCTCACACGCCAACCC	T =0.2604/1,304	Q399R
MTHFR	1:11796321	rs1801133	TTGAAGGAGAAGGTGTCTGCGGGAG [C/T]CGATTTCATCATCACGCAGCTTTTC	A =0.2454/1,229	C677T	Catalyzes the conversion of 5,10-methylenetetrahydrofolate to
	1:11794419	rs1801131	TGGGGGGAGGAGCTGACCAGTGAAG [A/C]AAGTGTCTTTGAAGTCTTCGTTCTT	G =0.2494/1,249	A1298C	5-methyltetrahydrofolate, and a cosubstrate for homocysteine remethylation to methionine
MTRR	5:7870860	rs1801394	AGGCAAAGGCCATCGCAGAAGAAAT [A/G]TGTGAGCAAGCTGTGGTACATGGAT	G =0.3642/1,824	A66G	Involved in the reductive regeneration of cobalamin cofactor required for the maintenance of methionine synthase in a functional state
MTR	1:236885200	rs1805087	GAAGAATATGAAGATATTAGACAGG [A/G]CCATTATGAGTCTCTCAAGGTAAGT	G =0.2183/1,093	A2756G	Cobalamin-dependent methionine synthase, catalyzes the final step in methionine biosynthesis
GSTM1	–	–	–	–	Null/present	Member of GST family that conjugates with glutathione and functions in the detoxification of carcinogens, environmental toxins and products of oxidative stress
GSTT1	–	–	–	–	Null/present	Member of GST family that catalyzes the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds

Note: ‘–’ indicates not available.

Abbreviations: SNPs, single-nucleotide polymorphisms; MAF, minor allele frequency; GST, glutathione S-transferase; A, adenine; G, guanine; C, cytosine; T, thymine.

Figure 2 Meta-analysis of the association between the MLLT10 polymorphism and meningioma risk under the allele model.

Notes: (A) Forest plot analysis; (B) Begg’s test with size graph symbol by weights; (C) Egger’s test with size graph symbol by weights; and (D) sensitivity meta-analysis. Weights are from fixed-effect analysis. The “given name study is omitted” was produced by the STAT12.0 software. It means the given name studies were omitted, and the meta-analysis data by other studies were showed.
Abbreviations: A, adenine; G, guanine; OR, odds ratio; CI, confidence interval; SE, standard error.

Table 3 Pooled analysis of the associations between MLLT10, CASP8, XRCC1, MTHFR, MTRR, and MTR polymorphisms and meningioma risk

Gene	SNP	Comparison	Number of studies	Sample size		Test of association		Heterogeneity		Model
				Case	Control	OR (95% CI)	P-value	I^2	P-value
MLLT10	rs12770228	A vs G	4	1,880	3,068	1.36 (1.24–1.48)	<0.001	16.6	0.309	F
		AA vs GG	4	1,880	3,068	1.84 (1.53–2.23)	<0.001	0	0.438	F
		GA vs GG	4	1,880	3,068	1.32 (1.13–1.54)	<0.001	27.7	0.246	R
		GA+AA vs GG	4	1,880	3,068	1.42 (1.23–1.64)	<0.001	28.7	0.24	R
		AA vs GG+GA	4	1,880	3,068	1.36 (1.24–1.48)	<0.001	0	0.552	F
CASP8	rs1045485	C vs G	7	806	1,271	1.14 (0.94–1.4)	0.181	2.6	0.406	F
		CC vs GG	6	730	1,199	1.67 (0.86–3.26)	0.129	5.5	0.382	F
		GC vs GG	7	806	1,271	1.06 (0.8–1.4)	0.687	26.4	0.227	R
		GC+CC vs GG	7	806	1,271	1.11 (0.89–1.39)	0.181	14.7	0.318	F
		CC vs GG+GC	6	730	1,199	1.14 (0.94–1.4)	0.102	3.6	0.393	F
XRCC1	rs1799782	T vs C	8	1,382	2,896	0.94 (0.82–1.07)	0.327	0	0.469	F
		TT vs CC	8	1,382	2,896	1.22 (0.89–1.69)	0.219	0	0.83	F
		CT vs CC	8	1,382	2,896	0.75 (0.61–0.94)	0.010	34.2	0.155	R
		CT+TT vs CC	8	1,382	2,896	0.82 (0.7–0.97)	0.018	23.8	0.24	F
		TT vs CC+CT	8	1,382	2,896	1.43 (1.05–1.95)	0.022	0	0.969	F
XRCC1	rs25487	A vs G	3	722	2,114	1.08 (0.89–1.31)	0.440	37	0.205	R
		AA vs GG	3	722	2,114	1.14 (0.67–1.95)	0.632	49.3	0.139	R
		GA vs GG	3	722	2,114	1.09 (0.85–1.4)	0.495	27.8	0.25	R
		GA+AA vs GG	3	722	2,114	1.1 (0.87–1.39)	0.429	25.3	0.262	R
		AA vs GG+GA	3	722	2,114	1.09 (0.63–1.86)	0.766	54.2	0.112	R
MTHFR	rs1801133	T vs C	10	1,323	1,883	1.14 (0.93–1.39)	0.222	64.2	0.003	R
		TT vs CC	10	1,323	1,883	1.31 (0.87–1.98)	0.201	52	0.027	R
		CT vs CC	10	1,323	1,883	1.19 (0.95–1.49)	0.132	43.8	0.066	R
		CT+TT vs CC	10	1,323	1,883	1.19 (0.92–1.53)	0.180	58.9	0.009	R
		TT vs CC+CT	10	1,323	1,883	1.22 (0.87–1.71)	0.239	36.6	0.115	R
MTHFR	rs1801131	C vs A	11	1,855	3,331	1.05 (0.95–1.15)	0.335	0	0.97	F
		CC vs AA	11	1,855	3,331	1.01 (0.82–1.24)	0.597	0	0.829	F
		AC vs AA	11	1,855	3,331	1.13 (0.99–1.29)	0.060	0	0.793	F
		AC+CC vs AA	11	1,855	3,331	1.11 (0.98–1.25)	0.108	0	0.935	F
		CC vs AA+AC	11	1,855	3,331	0.94 (0.77–1.15)	0.574	0	0.594	F
MTRR	rs1801394	G vs A	8	1,231	2,437	1.18 (1.06–1.31)	0.002	0	0.682	F
		GG vs AA	8	1,231	2,437	1.4 (1.14–1.73)	0.002	0	0.756	F
		AG vs AA	8	1,231	2,437	1.1 (0.93–1.3)	0.250	0	0.67	F
		AG+GG vs AA	8	1,231	2,437	1.18 (1.01–1.37)	0.036	0	0.622	F
		GG vs AA+AG	8	1,231	2,437	1.33 (1.1–1.61)	0.003	0	0.883	F
MTR	rs1805087	G vs A	7	939	1,210	0.89 (0.75–1.04)	0.140	0	0.51	F
		GG vs AA	7	939	1,210	0.96 (0.6–1.53)	0.867	0	0.985	F
		AG vs AA	7	939	1,210	0.84 (0.69–1.02)	0.074	10.4	0.35	F
		AG+GG vs AA	7	939	1,210	0.85 (0.7–1.02)	0.084	5.7	0.384	F
		GG vs AA+AG	7	939	1,210	1.02 (0.64–1.61)	0.946	0	0.986	F

Abbreviations: SNP, single-nucleotide polymorphism; OR, odds ratio; CI, confidence interval; F, fixed; R, random; A, adenine; G, guanine; C, cytosine; T, thymine.

Table 4 Begg’s test and Egger’s test data

Gene	SNP	Comparison	Begg’s test		Egger’s test
			z	P-value	t	P-value
MLLT10	rs12770228	A vs G	0.34	0.734	−0.59	0.613
		AA vs GG	1.02	0.308	−0.32	0.778
		GA vs GG	1.02	0.308	−2.02	0.18
		GA+AA vs GG	0.34	0.734	−1.24	0.341
		AA vs GG+GA	0.34	0.734	0.27	0.814
CASP8	rs1045485	C vs G	0.6	0.548	−0.17	0.87
		CC vs GG	0.38	0.707	−0.61	0.572
		GC vs GG	0.6	0.548	−0.4	0.708
		GC+CC vs GG	0.90	0.368	−0.31	0.77
		CC vs GG+GC	0.38	0.707	−0.64	0.56
XRCC1	rs1799782	T vs C	0.12	0.902	−0.71	0.506
		TT vs CC	0.37	0.711	0.36	0.731
		CT vs CC	0.37	0.711	−0.79	0.46
		CT+TT vs CC	0.62	0.536	−0.6	0.569
		TT vs CC+CT	−0.12	1	0.28	0.792
XRCC1	rs25487	A vs G	0	1	0.35	0.784
		AA vs GG	0	1	0.07	0.955
		GA vs GG	1.04	0.296	4.08	0.153
		GA+AA vs GG	1.04	0.296	1.3	0.418
		AA vs GG+GA	0	1	−0.16	0.897
MTHFR	rs1801133	T vs C	1.43	0.152	−2.33	0.048
		TT vs CC	0.54	0.592	−2.51	0.036
		CT vs CC	1.61	0.107	−1.88	0.097
		CT+TT vs CC	1.43	0.152	−2.23	0.056
		TT vs CC+CT	0.54	0.592	−1.96	0.086
MTHFR	rs1801131	C vs A	1.09	0.276	−0.59	0.571
		CC vs AA	1.09	0.276	−2.14	0.061
		AC vs AA	0.93	0.35	1.45	0.181
		AC+CC vs AA	0.47	0.64	0.92	0.38
		CC vs AA+AC	1.4	0.161	−2.37	0.042
MTRR	rs1801394	G vs A	1.11	0.266	−0.55	0.605
		GG vs AA	1.11	0.266	−0.64	0.544
		AG vs AA	−0.12	1	0.33	0.753
		AG+GG vs AA	−0.12	1	0.01	0.99
		GG vs AA+AG	1.61	0.108	−1.21	0.272
MTR	rs1805087	G vs A	0	1	−1.55	0.183
		GG vs AA	0.3	0.764	−0.73	0.497
		AG vs AA	0.3	0.764	−0.95	0.385
		AG+GG vs AA	0.3	0.764	−1.21	0.28
		GG vs AA+AG	0.3	0.764	−0.46	0.662

Abbreviations: SNP, single-nucleotide polymorphism; A, adenine; G, guanine; C, cytosine; T, thymine.

Table 5 Subgroup analysis of the association between XRCC1, MTHFR, and MTRR polymorphisms and meningioma risk

Comparison	XRCC1 rs1799782		MTHFR rs1801133		MTHFR rs1801131		MTRR rs1801394
	Asian	Caucasian	Asian	Caucasian	Asian	Caucasian	Asian	Caucasian
m vs M
Studies, n	6	2	2	8	4	7	3	5
Case-control	739/872	643/2,024	349/574	974/1,309	917/2,120	938/1,211	600/1,800	631/637
OR	0.95	0.89	1.19	1.11	1.02	1.07	1.17	1.19
95% CI	0.82–1.1	0.68–1.17	0.42–3.22	0.97–1.27	0.9–1.16	0.94–1.23	1.01–1.34	1.02–1.4
P-value	0.511	0.408	0.775	0.129	0.73	0.301	0.032	0.03
mm vs MM
Studies, n	6	2	2	8	4	7	3	5
Case-control	739/872	643/2,024	349/574	974/1,309	917/2,120	938/1,211	600/1,800	631/637
OR	1.2	2.3	1.44	1.18	1.08	0.92	1.41	1.4
95% CI	0.86–1.66	0.45–11.8	0.22–9.34	0.86–1.62	0.81–1.44	0.68–1.26	1.06–1.86	1.01–1.94
P-value	0.283	0.32	0.703	0.302	0.592	0.618	0.016	0.04
Mm vs MM
Studies, n	6	2	2	8	4	7	3	5
Case-control	739/872	643/2,024	349/574	974/1,309	917/2,120	938/1,211	600/1,800	631/637
OR	0.7	0.86	1.07	1.17	0.99	1.32	1.02	1.21
95% CI	0.52–0.95	0.64–1.14	0.35–3.26	0.97–1.42	0.83–1.19	1.09–1.59	0.82–1.27	0.94–1.54
P-value	0.022	0.282	0.902	0.11	0.931	0.004	0.827	0.136
Mm+mm vs MM
Studies, n	6	2	2	8	4	7	3	5
Case-control	739/872	643/2,024	349/574	974/1,309	917/2,120	938/1,211	600/1,800	631/637
OR	0.8	0.87	1.13	1.17	1.01	1.23	1.12	1.26
95% CI	0.66–0.97	0.66–1.15	0.31–4.17	0.98–1.4	0.85–1.19	1.03–1.48	0.91–1.37	1–1.59
P-value	0.026	0.331	0.85	0.08	0.932	0.023	0.277	0.052
mm vs MM+Mm
Studies, n	6	2	2	8	4	7	3	5
Case-control	739/872	643/2,024	349/574	974/1,309	917/2,120	938/1,211	600/1,800	631/637
OR	1.41	2.33	1.48	1.07	1.09	0.8	1.39	1.26
95% CI	1.03–1.93	0.45–11.99	0.42–5.25	0.79–1.44	0.83–1.43	0.6–1.08	1.08–1.78	0.94–1.68
P-value	0.031	0.31	0.547	0.674	0.552	0.146	0.01	0.121

Notes: M, major allele; m, minor allele.

Abbreviations: OR, odds ratio; CI, confidence interval.

Figure 3 Meta-analysis of the association between the GSTM1 polymorphism and meningioma risk.

Notes: (A) Forest plot analysis; (B) Begg’s test with size graph symbol by weights; (C) Egger’s test with size graph symbol by weights; and (D) sensitivity meta-analysis. Weights are from fixed-effect analysis. The “given name study is omitted” was produced by the STAT12.0 software. It means the given name studies were omitted, and the meta-analysis data by other studies were showed.
Abbreviations: OR, odds ratio; CI, confidence interval; SE, standard error.

Figure 4 Meta-analysis of the association between the GSTT1 polymorphism and meningioma risk.

Notes: (A) Forest plot analysis; (B) Begg’s test with size graph symbol by weights; (C) Egger’s test with size graph symbol by weights; and (D) sensitivity meta-analysis. Weights are from random-effect analysis. The “given name study is omitted” was produced by the STAT12.0 software. It means the given name studies were omitted, and the meta-analysis data by other studies were showed.
Abbreviations: OR, odds ratio; CI, confidence interval; SE, standard error.

AhnJYKimNKHanJHKimJKJooJYLeeKSGenetic mutation of 5,10-methylenetetrahydrofolate reductase in the brain neoplasmsJ Korean Neurosurg Soc2002323183188

 Google Scholar

BethkeLSullivanKWebbECASP8 D302H and meningioma risk: an analysis of five case-control seriesCancer Lett2009273231231518823701

 PubMedGoogle Scholar

BethkeLWebbEMurrayAFunctional polymorphisms in folate metabolism genes influence the risk of meningioma and gliomaCancer Epidemiol Biomarkers Prev20081751195120218483342

 PubMedGoogle Scholar

CacinaCPenceSTuranSAnalysis of CASP8 D302H gene variants in patients with primary brain tumorsIn Vivo201529560160426359420

 PubMedGoogle Scholar

CengizSLAcarHInanZYavuzSBayseferADeoxy-ribonucleic acid repair genes XRCC1 and XPD polymorphisms and brain tumor riskNeurosciences (Riyadh)200813322723221063329

 PubMedGoogle Scholar

De RoosAJRothmanNInskipPDGenetic polymorphisms in GSTM1, -P1, -T1, and CYP2E1 and the risk of adult brain tumorsCancer Epidemiol Biomarkers Prev2003121142212540498

 PubMedGoogle Scholar

DobbinsSEBroderickPMelinBCommon variation at 10p12.31 near MLLT10 influences meningioma riskNat Genet201143982582721804547

 PubMedGoogle Scholar

EganKMBaskinRNaborsLBBrain tumor risk according to germ-line variation in the MLLT10 locusEur J Hum Genet201523113213424755950

 PubMedGoogle Scholar

Elexpuru-CamiruagaJBuxtonNKandulaVSusceptibility to astrocytoma and meningioma: influence of allelism at glutathione S-transferase (GSTT1 and GSTM1) and cytochrome P-450 (CYP2D6) lociCancer Res19955519423742397671227

 PubMedGoogle Scholar

HuangGYFengJHaoSYAssociation of XRCC1 Arg194Trp polymorphism with meningiomaChin J Neurosurg2012428406410

 Google Scholar

HuangGYFengJHaoSYAssociation between DNA repair gene XRCC1 polymorphism and susceptibility to skull base meningiomaJ Int Neurol Neurosurg2015422144147

 Google Scholar

KafadarAMYilmazHKafadarDC677T gene polymorphism of methylenetetrahydrofolate reductase (MTHFR) in meningiomas and high-grade gliomasAnticancer Res2006263B2445244916821630

 PubMedGoogle Scholar

KiuruALindholmCHeinävaaraSXRCC1 and XRCC3 variants and risk of glioma and meningiomaJ Neurooncol200888213514218330515

 PubMedGoogle Scholar

LiRWangRLiYAssociation study on MTHFR polymorphisms and meningioma in northern ChinaGene2013516229129323276705

 PubMedGoogle Scholar

PinarbasiHSiligYGurelikMGenetic polymorphisms of GSTs and their association with primary brain tumor incidenceCancer Genet Cytogenet2005156214414915642394

 PubMedGoogle Scholar

RajaramanPHutchinsonAWichnerSDNA repair gene polymorphisms and risk of adult meningioma, glioma, and acoustic neuromaNeuro Oncol2010121374820150366

 PubMed Web of Science ®Google Scholar

RajaramanPWangSSRothmanNPolymorphisms in apoptosis and cell cycle control genes and risk of brain tumors in adultsCancer Epidemiol Biomarkers Prev20071681655166117684142

 PubMedGoogle Scholar

SchwartzbaumJAAhlbomALönnSAn international case-control study of glutathione transferase and functionally related polymorphisms and risk of primary adult brain tumorsCancer Epidemiol Biomarkers Prev200716355956517372252

 PubMedGoogle Scholar

SemmlerASimonMMoskauSLinnebankMPolymorphisms of methionine metabolism and susceptibility to meningioma formation: laboratory investigationJ Neurosurg20081085999100418447718

 PubMedGoogle Scholar

ZhangJZhouYWShiHP5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma riskJ Neurooncol2013115223323923959833

 PubMed Web of Science ®Google Scholar