Knockdown of a DIS3L2 promoter upstream long noncoding RNA (AC105461.1) enhances colorectal cancer stem cell properties in vitro by down-regulating DIS3L2

Figures & data

Table 1 Clinicopathological characteristics of patients with CRC

Age (years)	Sex	Tumor location	T stage	N stage	M stage	Pathological tumor type	Differentiation
50	F	Colon	T2	N0	M1	Adenocarcinoma	High
71	M	Colon	T2	N0	M0	Adenocarcinoma	High
60	M	Colon	T1	N0	M0	Adenocarcinoma	High
62	F	Colon	T3	N0	M0	Adenocarcinoma	Medium
76	M	Colon	T3	N1	M0	Adenocarcinoma	Medium
50	F	Colon	T3	N2	M0	Adenocarcinoma	Medium
39	F	Colon	T3	N0	M0	Adenocarcinoma	Medium
51	F	Colon	T3	N0	M0	Adenocarcinoma	Medium
76	M	Colon	T2	N0	M0	Adenocarcinoma	Medium
41	M	Colon	T2	N2	M0	Adenocarcinoma	Low
60	M	Colon	T3	N1	M1	Adenocarcinoma	Medium
58	M	Colon	T2	N0	M0	Adenocarcinoma	Medium
64	F	Colon	T4	N0	M1	Adenocarcinoma	Medium
74	M	Colon	T3	N1	M0	Adenocarcinoma	Medium
66	M	Colon	T3	N0	M0	Adenocarcinoma	Medium
54	F	Colon	T2	N0	M0	Adenocarcinoma	Medium
41	M	Rectum	T3	N0	M1	Adenocarcinoma	Low
59	M	Colon	T4	N1	M1	Adenocarcinoma	Low
36	M	Colon	T4	N1	M0	Adenocarcinoma	Low
54	M	Colon	T3	N0	M0	Adenocarcinoma	Medium
71	M	Rectum	T3	N1	M0	Adenocarcinoma	Medium
42	M	Colon	T4	N2	M0	Adenocarcinoma	Low
64	M	Colon	T3	N0	M0	Adenocarcinoma	Medium
64	M	Colon	T3	N1	M1	Adenocarcinoma	Medium
52	M	Terminal ileum	T3	N2	M0	Adenocarcinoma	Medium
75	F	Colon	T3	N2	M1	Adenocarcinoma	Medium
70	F	Rectum	T4	N0	M1	Adenocarcinoma	Medium
61	M	Ileocecum	T4	N1	M0	Adenocarcinoma	Medium
58	M	Colon	T3	N0	M0	Adenocarcinoma	Medium
70	M	Rectum	T3	N1	M1	Adenocarcinoma	Medium
45	F	Colon	T3	N0	M0	Adenocarcinoma	Low
41	M	Colon	T2	N2	M0	Adenocarcinoma	Low
52	M	Rectum	T3	N1	M1	Adenocarcinoma	Low
39	M	Rectum	T1	N0	M0	Adenocarcinoma	Low
73	F	Rectum	T4	N2	M0	Adenocarcinoma	High
67	F	Colon	T3	N0	M0	Adenocarcinoma	High
55	M	Rectum	T3	N2	M0	Adenocarcinoma	Low
45	M	Rectum	T3	N0	M0	Adenocarcinoma	Medium
48	M	Colon	T3	N2	M1	Adenocarcinoma	Medium
70	M	Rectum	T3	N0	N0	Adenocarcinoma	Low
51	F	Colon	T2	N1	M1	Adenocarcinoma	High
53	M	Colon	T3	N1	M1	Adenocarcinoma	High
48	F	Rectum	T3	N0	M0	Adenocarcinoma	Low
56	M	Colon	T3	N2	M1	Adenocarcinoma	Medium
66	F	Colon	T2	N2	M0	Adenocarcinoma	Medium
55	F	Colon	T3	N1	M1	Adenocarcinoma	Medium
49	F	Colon	T3	N2	M1	Adenocarcinoma	Medium

Abbreviations: CRC, colorectal cancer; M, male; F, female; T, tumor; N, lymph Node; M, metastasis.

Table 2 Primers for real-time PCR analysis

Gene name	Forward (5′–3′)	Reverse (5′–3′)
DIS3L2	ATGAGCCATCCTGACTACAGAA	AAGCACCAATGTCATGTGGAC
AC105461.1	GCCTTCTGAAACATCCTCCTTG	CTCTTTTACCTCGCCTTGGG
GAPDH	GAAGGTGAAGGTCGGAGTC	GAAGATGGTGATGGGATTTC

Abbreviation: PCR, polymerase chain reaction.

Table 3 Sequences for small interfering RNA analysis

Gene name	Sense (5′–3′)	Antisense (5′–3′)
AC105461.1-si1	CUCUGAGAUGAAUAAGGAAAAUUAC	GUAAUUUUCCUUAUUCAUCUCAGAGAA
AC105461.1-si2	CAUAUUCUCUGAGAUGAAUAAGGAA	UUCCUUAUUCAUCUCAGAGAAUAUGAU

Figure 1 The expression of AC105461.1 was down-regulated in CRC tissue samples (*P<0.05).

Abbreviations: CRC, colorectal cancer; T, tumor; N, normal.

Figure 2 AC105461.1 expression was correlated with DIS3L2 (P<0.001).

Figure 3 AC105461.1 expression levels were assessed by real-time PCR in five cell lines (*P<0.05).

Abbreviation: PCR, polymerase chain reaction.

Figure 4 Coregulation of DIS3L2 expression with AC105461.1 overexpression or knockdown in CRC cell lines. (A) Overexpression experiment showed that AC105461.1 expression was markedly elevated and DIS3L2 expression level was also apparently upregulated by pcDNA-AC105461.1 in SW620 cells. (B) Real-time PCR analysis showed that the expressions of both AC105461.1 and DIS3L2 in AC105461.1 siRNA group were significantly knocked down in SW480 cells (*P<0.05).

Abbreviations: CRC, colorectal cancer; pcDNA, plasmid complementary DNA; real-time PCR, real-time quantitative polymerase chain reaction; NC, negative control; si, small interfering.

Figure 5 AC105461.1 overexpression impaired the CSC properties. (A) Cell proliferation assay showed that cell growth of SW620 cells in pcDNA-AC105461.1 was evidently slower than that in pcDNA-NC (*P<0.05). (B, C) The matrigel invasion assay conducted in SW620 cells exerted significant cell invasion inhibition in pcDNA-AC105461.1 compared with pcDNA-NC (*P<0.05). (D, E) Spheroid formation assay revealed that the spheroid formation rate in pcDNA-AC105461.1 was obviously slower compared with that in pcDNA-NC (*P<0.05). (F) Flow cytometric analysis suggested that the percentage of CD133⁺CD44⁺ in pcDNA-AC105461.1 group (2.01%) was low when compared with pcDNA-NC group (12.1%).

Abbreviations: CSC, cancer stem cell; pcDNA, plasmid complementary DNA; NC, negative control.

Figure 6 AC105461.1 knockdown enhanced the CSC properties. (A) Cell proliferation assay illustrated that cell growth of SW480 cells in AC105461.1 siRNA group was markedly higher than that in NC-si (*P<0.05). (B, C) The matrigel invasion assay also showed significant cell invasion enhancement in AC105461.1 siRNA group in contrast to the NC group in SW480 cells (*P<0.05). (D, E) Spheroid formation assay demonstrated that the spheroid formation rate in AC105461.1-si1 was obviously higher than that in NC-si (*P<0.05). (F) Flow cytometric analysis showed that the percentage of CD133⁺CD44⁺ in AC105461.1 siRNA group is 4.39% and that in NC-si group is 0.96%, which illustrated that AC105461.1 knockdown enhanced the percentage of CD133⁺CD44⁺.

Abbreviations: CSC, cancer stem cell; NC, negative control; si, small interfering.