Downregulation of lncRNA SDPR-AS is associated with poor prognosis in renal cell carcinoma

Figures & data

Table 1 List of primers and their sequences used in this study

Gene	Sequence (5′-3′)
Primers for GAPDH
GAPDH
Forward	AATGGACAACTGGTCGTGGAC
Reverse	CCCTCCAGGGGATCTGTTTG
Primers for SDPR
SDPR
Forward	CTCCGGGTGGGTTTTTACGAC
Reverse	CTGCGTTTTGGTGACTCGATG
Primers for SDPR-AS
SDPR-AS
Forward	GTTGCCCTATCCTGCTTTTCAC
Reverse	AGACTGGGGATTAGCCTGGTGT
SDPR-AS-si1
SDPR-AS-si1
Forward	CACAUCAACCUGUCAUACUAGUUGT
Reverse	ACAACUAGUAUGACAGGUUGAUGUGGC
SDPR-AS-si2
SDPR-AS-si2
Forward	GAGCUUGGUGAGGUCAUUCUGGATG
Reverse	CAUCCAGAAUGACCUCACCAAGCUCUC

Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SDPR, serum deprivation response; SDPR-AS, antisense (AS) transcript of SDPR; SDPR-AS-si, small interfering RNA (siRNA) for target SDPR-AS.

Figure 1 Downregulation of both SDPR-AS and SDPR expression in RCC tissue samples.

Notes: (A) The expression level of SDPR-AS was significantly reduced in tumor tissues, especially in TNM stage III and stage IV (***P<0.001). (B) The expression level of SDPR-AS was significantly downregulated in tumor tissues (***P<0.001).
Abbreviations: SDPR, serum deprivation response; SDPR-AS, antisense (AS) transcript of SDPR; RCC, renal cell carcinoma; TNM, tumor node metastasis.

Figure 2 Expressions of SDPR-AS and SDPR are positively correlated.

Abbreviations: SDPR, serum deprivation response; SDPR-AS, antisense (AS) transcript of SDPR.

Figure 3 SDPR expression was co-regulated with SDPR-AS overexpression or knockdown in RCC cell lines.

Notes: (A, B) The expression levels of SDPR-AS and SDPR were highest in the 769-P and lowest in the OS-RC-2 cell lines among the six RCC cell lines (*P<0.05). (C) After being transfected with pcDNA-SDPR-AS plasmid, SDPR-AS was overexpressed in the OS-RC-2 cell line, while the expression level of SDPR was apparently up-regulated (*P<0.05). (D) SDPR-AS expression was significantly decreased in the 769-P cell line transfected with SDPR-AS-si (*P<0.05).
Abbreviations: SDPR, serum deprivation response; SDPR-AS, antisense (AS) transcript of SDPR; NC, negative control; pc, plasmid complementary; HKC, renal tubular cell.

Figure 4 Overexpression of SDPR-AS suppressed the migration and invasion of OS-RC-2 cell line but had no evident association with proliferation.

Notes: (A) There was no significant difference in the growth of OS-RC-2 cells transfected with either pcDNA-SDPR-AS or pcDNA control. (B) The wound healing assay showed significant inhibition of cell migration by pcDNA-SDPR-AS compared to the pcDNA control (*P<0.05). (C) The matrigel invasion assay also revealed remarkable suppression of cell invasion by pcDNA-SDPR-AS compared to the pcDNA control (*P<0.05). 40× magnification.
Abbreviations: pc, plasmid complementary; SDPR, serum deprivation response; SDPR-AS, antisense (AS) transcript of SDPR.

Figure 5 Knockdown of SDPR-AS promoted the migration and invasion of 769-P cell line but showed no evident association with proliferation.

Notes: (A) There was no evident difference in proliferation of 769-P cell line transfected with either SDPR-AS-si or NC si. (B, C) The wound healing and matrigel invasion assays revealed a significantly enhanced migration and invasion abilities of 769-P cells treated with SDPR-AS-si compared with those treated with NC si (*P<0.05). 40× magnification.
Abbreviations: NC, negative control; SDPR, serum deprivation response; SDPR-AS, antisense (AS) transcript of SDPR.

Table 2 Correlation between SDPR-AS expression and clinicopathologic features of RCC patients

Clinicopathologic features	Number of cases	SDPR-AS expression		χ^2	P-value
		Lowa	Higha
Total	56	35	21
Age (years)				0.005	0.945
<50	27	17	10
≥50	29	18	11
Tumor size (cm)				2.124	0.145
≤4.0	25	13	12
>4.0	31	22	9
Tumor location				2.221	0.329
Upper pole	17	10	7
Middle	20	15	5
Lower pole	19	10	9
Differentiation grade				4.065	0.044
Low	20	9	11
High	36	26	10
TNM stage				5.973	0.015
Stage I–II	16	6	10
Stage III–IV	40	29	11
Lymph node metastasis				6.310	0.012
Positive	38	28	10
Negative	18	7	11

Notes:

a Low, SDPR-AS expression ratio ≤ median ratio, n=56; High, SDPR-AS expression ratio ≥ median ratio, n=56.

Abbreviations: RCC, renal cell carcinoma; SDPR, serum deprivation response; SDPR-AS, antisense (AS) transcript of SDPR; TNM, tumor node metastasis.

Figure 6 The association between SDPR-AS expression and prognosis of RCC patients.

Abbreviations: RCC, renal cell carcinoma; SDPR, serum deprivation response; SDPR-AS, antisense (AS) transcript of SDPR.