Novel long noncoding RNA GACAT3 promotes colorectal cancer cell proliferation, invasion, and migration through miR-149

Figures & data

Figure 1 GACAT3 expression is elevated in CRC tissues and cell lines.

Notes: (A) The expression of GACAT3 was detected by qRT-PCR in 26 clinical CRC samples compared to those in adjacent normal tissue samples. (B) GACAT3 expression in four CRC cell lines HT29, HCT116, SW480, and LoVo was higher compared with the normal colorectal epithelium cell line FHC. *P<0.05.
Abbreviations: CRC, colorectal cancer; GACAT3, gastric cancer-associated transcript 3; qRT-PCR, quantitative real-time PCR.

Figure 2 Knockdown of GACAT3 inhibited cell proliferation in vivo and in vitro.

Notes: (A) The si-GACAT3 or control was transfected into the CRC cell lines. GACAT3 levels were decreased significantly after transfection in HT-29 and LoVo cells. *P<0.05. (B, C) MTT assay was performed to determine the proliferation of HT29 and LoVo cells. GACAT3 silencing notably inhibited the cell proliferation. *P<0.05. (D, E) Colony formation ability was also inhibited by si-GACAT3 in HT29 and LoVo cells. *P<0.05. (F) Knockdown of GACAT3 in CRC cells significantly inhibits tumor growth in a mouse xenograft model, *P<0.05 compared with control. (G) Tumor weights of corresponding mouse xenograft models, *P<0.05 compared with control.
Abbreviations: CRC, colorectal cancer; GACAT3, gastric cancer-associated transcript 3; MTT, 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide.

Figure 3 Knockdown of GACAT3 inhibited cell migration and invasion in vitro.

Notes: (A, B) Knockdown of GACAT3 decreased cell invasion by Transwell assay in HT-29 and LoVo cells. *P<0.05. (C, D) Knockdown of GACAT3 decreased cell migration by Transwell assay in HT-29 and LoVo cells. *P<0.05.
Abbreviation: GACAT3, gastric cancer-associated transcript 3.

Figure 4 GACAT3 is identified as the functional downstream target of miR-149.

Notes: (A) The results of bioinformatics analysis showed the potentially targeted miRNA of GACAT3. (B) The expression of potentially targeted miRNA for GACAT3 was determined by qRT-PCR in 293T cells. *P<0.05. (C) Sequence alignment of human GACAT3 with the miR-149. The seed sequence of GACAT3 (middle) matches the 3′-UTR of miR-149 (top). Bottom, mutation of the 3′-UTR of GACAT3 in the mutant luciferase reporter construct. (D) Application of si-GACAT3 increases miR-149 levels in HT29 and LoVo cells. *P<0.05. (E) The luciferase reporter assay was used to detect the activity of GACAT3 in HT-29 cells cotransfected with lncRNA-CRNDE (Wt or Mut) and miR-149 mimics or scramble. *P<0.05. (F) The qRT-PCR was performed to detect miR-149 in the samples pulled down by GACAT3 probe. *P<0.05.
Abbreviations: 3′-UTR, 3′-untranslated region; GACAT3, gastric cancer-associated transcript 3; qRT-PCR, quantitative real-time PCR.

Figure 5 Regulation of CRC cell clone formation, invasion, and the expression of SP1 and STAT3 by GACAT3 requires miR-149.

Notes: (A) Expression levels of miR-149 were detected through qRT-PCR in HT29 and LoVo cells transfected with control, si-GACAT3, or anti-miR-149. (B) Colony formation assay and invasion assay (C) were performed in HT29 and LoVo cells transfected with control, si-GACAT3, or anti-miR-149. (D) Expression levels of SP1 were determined in HT29 and LoVo cells transfected with control, si-GACAT3, or anti-miR-149. (E, F) Expression levels of STAT3 were determined in HT29 and LoVo cells transfected with control, si-GACAT3, or anti-miR-149. (G) Lnc GACAT3 promotes CRC cell carcinogenesis via miR-149-mediated regulation of SP1 and STAT3 signaling. *P<0.05.
Abbreviations: CRC, colorectal cancer; GACAT3, gastric cancer-associated transcript 3; qRT-PCR, quantitative real-time PCR; SP1, specificity protein 1.

Table S1 The sequences of primer used for qRT-PCR

Gene	Forward primer (5′–3′)	Reverse primer (5′–3′)
GACAT3	CTTCCGGAGCAGGTCTGAGT	CTTTCCCTGCAGAGACCAGT
miR-1207–5p	GTTAGGGCAGGTGGGATG	TGTATGCGGCTGGTAAGTAG
miR-149	GGCTCTGGCTCCGTGTCTT	CAGTGCAGGGTCCGAGGTATT
miR-3649	ACACTCCAGCTGGGAGGGACCTGAGTG	TGGTGTCGTGGAGTCG
miR-3689b	TGCGGCTGGGAGGTGTGATAT	GTGCAGGGTCCGAGGT
SP1	TGGCAGCAGTACCAATGGC	CCAGGTAGTCCTGTCAGAACTT
GAPDH	GTCAACGGATTTGGTCTGTATT	AGTCTTCTGGGTGGCAGTGAT

Abbreviations: GACAT3, gastric cancer-associated transcript 3; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; qRT-PCR, quantitative real-time PCR; SP1, specificity protein 1.