Effects of the combination of As₂O₃ and AZT on proliferation inhibition and apoptosis induction of hepatoma HepG2 cells following silencing of Egr-1

Figures & data

Table 1 Primer sequence

Gene	Primer sequence (5′→3′)
Egr-1	Forward: CAGCTTGGTCAGTGGCCTAGT
	Reverse: AATGTCAGTGTTCGGCGTGG
p53	Forward: TCGAAATGTTCCGAGAGCTGAAT
	Reverse: GTCTGAGTCAGGCCCTTCTGTCTT
Caspase-3	Forward: AAATACCAGTGGAGGCCGAC
	Reverse: TTTCAGCTAGGCACAAAGCG
β-actin	Forward: TGGCACCCAGCACAATGAA
	Reverse: CTAAGTCATAGTCCGCCTAGAAGCA

Figure 1 The HepG2 cells were transfected with Egr-1 siRNA.

Notes: (A1) and (A2) show the cells which were observed under phase contrast microscope at 10 and 24 h, respectively, 200×; (B1) and (B2) show the cells which were observed under fluorescence microscope at 10 and 24 h, respectively, 200×. The transfected cells emitted green fluorescence.
Abbreviation: Egr-1, early growth response protein 1.

Figure 2 qPCR method to detect transfection efficiency.

Abbreviations: Egr-1, early growth response protein 1; qPCR, real-time quantitative polymerase chain reaction; RQ, relative quantity.

Table 2 Cell proliferation rate after transfection

Group	24 h	48 h	72 h
Mock	100.00±10.13	100.00±10.29	100.00±10.26
HepG2/NC	97.73±11.67	98.14±12.14	94.96±10.17
HepG2/siRNA	135.39±12.14a,b,*	137.15±12.3a,b,*	95.32±10.31

Notes:

a HepG2/siRNA and mock groups at the same time point;

b HepG2/siRNA and HepG2/NC groups at the same time point;

* P<0.05. Data presented as mean ± SD, %, n=3.

Abbreviation: NC, negative control.

Figure 3 Effect of As₂O₃ combined with AZT on cell proliferation inhibition.

Notes: (A) AZT = 10 μmol/L; (B) AZT = 20 μmol/L. ^aCompared with transfection before, *P<0.05; ^bcompared with mock, ^#P>0.05; ^ccompared with As₂O₃ or AZT alone of the same group, **P<0.01, ^#P>0.05.
Abbreviations: As₂O₃, arsenic trioxide; AZT, 3′-azido-3′-deoxythymidine; Egr-1, early growth response protein 1; NC, negative control.

Table 3 CI value of combination of As₂O₃ and AZT in the three groups of cells (72 h)

As2O3+ AZT (μmol/L)	Groups	Fa	CI
2+10	Mock	0.608	0.174
	HepG2/NC	0.583	0.193
	HepG2/siRNA	0.243	1.032
2+20	Mock	0.518	0.261
	HepG2/NC	0.484	0.303
	HepG2/siRNA	0.153	3.328

Abbreviations: As₂O₃, arsenic trioxide; AZT, 3′-azido-3′-deoxythymidine; CI, combination index; Fa, ratio of the fraction affected; NC, negative control.

Figure 4 Effects of As₂O₃ combined with AZT on cell apoptosis.

Notes: ^aCompared with blank control group, *P<0.05, **P<0.01; ^bcompared with HepG2 or HepG2/NC, **P<0.01.
Abbreviations: As₂O₃, arsenic trioxide; AV FITC-A, Annexin V fluorescein isothiocyanate-area; AZT, 3′-azido-3′-deoxythymidine; Egr-1, early growth response protein 1; LL, lower left; LR, lower right; NC, negative control; PE-A, phycoerythrin-area under the curve; PI, propidium iodide; UL, upper left; UR, upper right.

Figure 5 Relative expression of Egr-1 mRNA in HepG2 cells.

Notes: (A) Compared with mock or HepG2/NC group, **P<0.01. (B) ^aCompared with blank control group, **P<0.01.
Abbreviations: Egr-1, early growth response protein 1; NC, negative control.

Figure 6 The expression levels of Egr-1 protein in HepG2 cells (n=3).

Note: Compared with control, **P<0.01.
Abbreviations: Egr-1, early growth response protein 1; NC, negative control.

Figure 7 The effect of Egr-1 on expression of p53 and caspase-3 mRNA in HepG2 cells.

Notes: Mock, adding the same amount of culture medium; NC, transfection of nonspecific sequence; Egr-1 siRNA, transfected with Egr-1 siRNA; compared with mock group or NC group, **P<0.01.
Abbreviations: Egr-1, early growth response protein 1; NC, negative control.

Figure 8 The effect of Egr-1 on expression of p53 and caspase-3 protein in HepG2 cells.

Notes: Mock, adding the same amount of culture medium; NC, transfection of nonspecific sequence, Egr-1 siRNA, transfected with Egr-1 siRNA; compared with mock group or NC group, **P<0.01.
Abbreviations: Egr-1, early growth response protein 1; NC, negative control.