Resveratrol inhibits the proliferation of A549 cells by inhibiting the expression of COX-2

Figures & data

Table 1 The amplification primers for the COX-2 gene and GAPDH internal reference

Name of primer	Sequences
COX-2-F	AGCTAGCTAGGACTGATCGCTAC
COX-2-R	CGTAGTCGCGGCTAGCTAGCTAGC
GAPDH-F	GTCGATGGCTAGTCGTAGCATCGAT
GAPDH-R	TGCTAGCTGGCATGCCCGATCGATC

Abbreviation: GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Figure 1 COX-2 mRNA relative expression in lung adenocarcinoma was related to the clinical stage. *P<0.01 or ^#P<0.01 or ^&P<0.01 when compared with COX-2 mRNA relative expression in the other three groups.

Figure 2 MTT assay was performed to detect the effect of resveratrol on A549 cell proliferation. *P<0.01 when compared with other groups at the same time.

Notes: For BEAS-2B cell suspensions, they were continuously cultured in conventional RPMI 1640 medium and were named as Group A. For A549 cell suspensions, they were cultured in RPMI 1640 medium containing different concentrations of resveratrol. Resveratrol concentrations were 0 μmol/L, 20 μmol/L, 40 μmol/L, 60 μmol/L, and 80 μmol/L, respectively, and according to the concentration of resveratrol, they were named as Group B, Group B₂₀, Group B₄₀, Group B₆₀, and Group B₈₀, respectively.

Figure 3 Effects of resveratrol on malignant proliferation of A549 cells. (A) soft agar clone; (B) colony formation rate. *P<0.01 when compared with the other two groups.

Notes: For BEAS-2B cell suspensions, they were continuously cultured in conventional RPMI 1640 medium and were named as Group A. For A549 cell suspensions, they were cultured in RPMI 1640 medium containing different concentrations of resveratrol. Group B had resveratrol concentration of 0 μmol/L and Group B₆₀ had resveratrol concentration of 60 μmol/L.

Figure 4 Effects of resveratrol on cell cycle of A549 cells. (A) Flow cytometry was performed to determine cell cycle. (B) Ratio of S phase A549 cell. *P<0.01 when compared with the other two groups.

Notes: For BEAS-2B cell suspensions, they were continuously cultured in conventional RPMI 1640 medium and were named as Group A. For A549 cell suspensions, they were cultured in RPMI 1640 medium containing different concentrations of resveratrol. Group B had resveratrol concentration of 0 μmol/L and Group B₆₀ had resveratrol concentration of 60 μmol/L.

Figure 5 Effects of resveratrol on the expression of COX-2 in A549 cells. (A) Expression of COX-2 mRNA by qRT-PCR. (B) Expression of COX-2 protein by Western blot. *P<0.01 when compared with the other two groups.

Notes: For BEAS-2B cell suspensions, they were continuously cultured in conventional RPMI 1640 medium and were named as Group A. For A549 cell suspensions, they were cultured in RPMI 1640 medium containing different concentrations of resveratrol. Group B had resveratrol concentration of 0 μmol/L and Group B₆₀ had resveratrol concentration of 60 μmol/L.
Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; qRT-PCR, quantitative reverse transcription polymerase chain reaction.

Figure 6 Silencing of COX-2 gene inhibits COX-2 protein expression. (A) Blotting of protein by Western blot. (B) Statistical data of protein by Western blot. *P<0.01 when compared with the other two groups.

Abbreviation: GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Figure 7 Resveratrol inhibits the proliferation of A549 cells by inhibiting COX-2 expression. (A) Proliferation of A549 cells in each group. (B) Colony formation rate of each group. (C) Ratio of S phase A549 cell in each group. *P<0.01 when compared with the other three groups; ^#P<0.05 when compared with Resveratrol group and siRNA-COX-2 group.