Comprehensive bioinformatics analysis identifies several potential diagnostic markers and potential roles of cyclin family members in lung adenocarcinoma

Figures & data

Table 1 The primer sequences for qRT-PCR analyses

Gene	Forward primer (5′–3′)	Reverse primer (5′–3′)
NPAS2	CGTGTTGGAAAAGGTCATCGG	TCCAGTCTTGCTGAATGTCAC
GNG7	ATGTCAGCCACTAACAACATAGC	AGACCTTGATGCGCTCAATCC
SLC2A1	GGCCAAGAGTGTGCTAAAGAA	ACAGCGTTGATGCCAGACAG
CHIA	ATCCAGTCTGGCTATGAGATCC	TCAGTCGGGTATTTGTAGAGGG
GAPDH	TGACAACTTTGGTATCGTGGAAGG	AGGCAGGGATGATGTTCTGGAGAG

Abbreviation: qRT-PCR, quantitative real-time PCR.

Table 2 The enriched GO BP and pathway for overlapping upregulated and downregulated genes, respectively

Expression	Category	Term	Count	P-value
Upregulated	GOTERM_BP_FAT	GO:0007067–mitotic nuclear division	33	2.34E–11
	GOTERM_BP_FAT	GO:0051301–cell division	38	2.32E–10
	GOTERM_BP_FAT	GO:0006260–DNA replication	20	6.23E–07
	GOTERM_BP_FAT	GO:0030574–collagen catabolic process	13	8.05E–07
	GOTERM_BP_FAT	GO:0000082–GI/S transition of mitotic cell cycle	14	2.42E–05
	KEGG_PATHWAY	hsa04110:Cell cycle	18	1.31E–06
	KEGG_PATHWAY	hsa04974:Protein digestion and absorption	12	2.37E–04
	KEGG_PATHWAY	hsa01230:Biosynthesis of amino acids	11	2.38E–04
	KEGG_PATHWAY	hsa04115:p53 signaling pathway	10	5.10E–04
	KEGG_PATHWAY	hsa00250:Alanine, aspartate, and glutamate metabolism	7	0.001224098
Downregulated	GOTERM_BP_FAT	GO:0006955–immune response	99	3.92E–19
	GOTERM_BP_FAT	GO:0006952–defense response	91	1.81E–18
	GOTERM_BP_FAT	GO:0009611–response to wounding	80	8.98E–17
	GOTERM_BP_FAT	GO:0001944–vasculature development	52	1.11E–16
	GOTERM_BP_FAT	GO:0001568–blood vessel development	50	1.08E–15
	KEGG_PATHWAY	hsa04610:Complement and coagulation cascades	18	1.09E–06
	KEGG_PATHWAY	hsa05332:Graft-versus-host disease	13	3.51E–06
	KEGG_PATHWAY	hsa04514:CAMs	22	9.33E–05
	KEGG_PATHWAY	hsa04940:Type I diabetes mellitus	11	2.56E–04
	KEGG_PATHWAY	hsa04270:Vascular smooth muscle contraction	19	2.59E–04

Abbreviations: BP, biological process; CAMs, cell adhesion molecules; GO, Gene Ontology.

Figure 1 Four modules extracted from the PPI network.

Note: Red node indicates upregulated genes, and green node represents downregulated genes. Abbreviation: PPI, protein–protein interaction.

Figure 2 TF–miRNA–target network of the overlapping DEGs.

Notes: Red node indicates upregulated genes, and green node indicates downregulated genes. White triangle represents TF, and white quadrilateral represents miRNA. Among them, the DEG FOXM1 is also a TF.
Abbreviations: DEGs, differentially expressed genes; TF, transcription factor.

Figure 3 Survival curves.

Notes: (A) Survival curves of NPAS2 expression. (B) Survival curves of GNG7 expression. (C) Survival curves of CHIA expression. (D) Survival curves of SLC2A1 expression.

Figure 4 qRT-PCR validation of the expression of NPAS2 (A), GNG7 (B), CHIA (C), and SLC2A1 (D) in the human non-small-cell lung cancer cell line A549 compared with those in the human normal bronchial epithelial cell line BEAS-2B. *P-value<0.05.

Abbreviation: qRT-PCR, quantitative real-time PCR.

Figure S1 PPI network of the overlapping DEGs.

Abbreviations: DEGs, differentially expressed genes; PI, protein–protein interaction.