CPEB4 promotes growth and metastasis of gastric cancer cells via ZEB1-mediated epithelial– mesenchymal transition

Figures & data

Table 1 Relationship between CPEB4 expression and clinico-pathological features in gastric cancer

Features	n	CPEB4		P-value
		Negative	Positive
Age (years)				0.834
≥60	76	48	28
<60	36	22	14
Gender				0.188
Male	77	45	32
Female	35	25	10
Tumor size (cm)				0.002a
≥5	66	49	17
<5	46	21	25
Lauren’s classification				0.403
Diffuse	29	20	9
Intestinal	83	50	33
Lymphatic vessel invasion				0.252
With	45	31	14
Without	67	39	28
T stage				0.001a
T1 + T2	50	23	27
T3 + T4	62	47	15
pTNM stage				0.004a
I + II	47	22	25
III + IV	65	48	17
Lymph node metastasis				<0.001a
With (N1 + N2 + N3)	67	53	14
Without (N0)	45	17	28

Note:

a Mean P<0.05.

Abbreviation: CPEB4, cytoplasmic polyadenylation element-binding protein 4.

Table 2 Correlation analysis between CPEB4 expression and ZEB1 expression in gastric cancer tissues by chi-squared test

Gene	CPEB4
	Positive	Negative	χ^2	P-value	C
ZEBI
Positive	58	11	35.637	<0.001a	0.491
Negative	12	31

Notes: C, contingency coefficient.

a Mean P<0.05.

Abbreviation: CPEB4, cytoplasmic polyadenylation element-binding protein 4.

Figure 1 Relative CPEB4 expression in GC tissues and its clinical significance.

Notes: (A) Western blot analysis of CPEB4 expression in GC tumor tissues and matched normal tissues. Magnification ×200. (B) Representative IHC images of CPEB4 and ZEB1 in GC tumor tissues and adjacent normal tissues. (C) Quantitative evaluation of CPEB4 expression in tumor tissues and corresponding normal tissues in accordance with staining scores. (D) Scatterplots of the average staining scores of CPEB4 expression in patients without or with metastasis. (E) Kaplan–Meier survival curves for GC patients with CPEB4 expression. *P<0.05.
Abbreviations: CPEB4, cytoplasmic polyadenylation element-binding protein 4; GC, gastric cancer; IHC, immunohistochemistry.

Figure 2 Effects of CPEB4 silencing or overexpression on GC cells’ migration, invasion, and proliferation in vitro.

Notes: (A) Detection of relative expression of CPEB4 protein in GC cell lines and normal gastric epithelial GES-1 cells by Western blot. (B and C) Successful knockdown of CPEB4 in SGC7901 cells and CPEB4 overexpression in AGS cells were confirmed by Western blot and immunofluorescence. Magnification ×400. (D and E) The effects of CPEB4 expression on the migration and invasion ability of SGC7901 and AGS cells were determined by wound-healing assay and transwell assay. The effects of CPEB4 expression on the proliferation ability of SGC7901 and AGS cells were measured by the CCK-8 assay. Magnification ×100. (F), colony formation assay (G), and EdU assay (H). *P<0.05. Magnification ×200.
Abbreviations: CCK-8, cell-counting kit-8; CPEB4, cytoplasmic polyadenylation element-binding protein 4; GC, gastric cancer.

Figure 3 Effects of different expression levels of CPEB4 on EMT-related markers in SGC7901 and AGS cells.

Notes: Following CPEB4 shRNA or overexpression treatment, qRT-PCR (A), Western blot (B), and immunofluorescence (C) were used to determine the expressions of EMT-related markers in CPEB4-altered cells, including the epithelial marker E-cadherin, the mesenchymal markers N-cadherin and Vimentin, and transcription factors (Snail, Slug, ZEB1, SIP1, and Twist). *P<0.05. Magnification ×400.
Abbreviations: CPEB4, cytoplasmic polyadenylation element-binding protein 4; EMT, epithelial–mesenchymal transition; qRT-PCR, quantitative real-time PCR; shRNA, short hairpin RNA.

Figure 4 CPEB4 induced GC cells’ migration, invasion, and growth via ZEB1-mediated EMT.

Notes: (A) Insight into the ZEB1-dependent mechanism of CPEB4-induced GC cells’ EMT by Western blot. (B) Confirmation of the ZEB1-dependent mechanism of CPEB4-facilitating GC cells’ migration and invasion by transwell assay. Exploration of the ZEB1-dependent mechanism of CPEB4-induced GC cells growth by the CCK-8 assay. Magnification ×200. (C), EdU assay (D), and colony formation assay. Magnification ×100. (E). *P<0.05.
Abbreviations: CCK-8, cell-counting kit-8; CPEB4, cytoplasmic polyadenylation element-binding protein 4; EMT, epithelial–mesenchymal transition; GC, gastric cancer.

Figure 5 Influences of CPEB4 silencing or overexpression on GC cells’ tumor growth in vivo.

Notes: (A) Representative images of tumors formed in nude mice injected subcutaneously with GC cells. Tumor volume was measured every 5 days. At 30 days after inoculation, nude mice were sacrificed and tumors were weighed. (B) Expressions of CPEB4, E-cadherin, ZEB1, N-cadherin, and Vimentin in xenograft tumors were determined in each group by Western blot. (C) Expressions of CPEB4 and Ki-67 in xenograft tumors were detected in each group by immunohistochemistry. n=6 in each group. *P<0.05. Magnification ×200.
Abbreviations: CPEB4, cytoplasmic polyadenylation element-binding protein 4; GC, gastric cancer.

Figure 6 Effects of CPEB4 silencing or overexpression on the metastasis of GC cells in vivo.

Notes: (A) The lung metastatic nodules were counted. (B) Expressions of CPEB4, E-cadherin, ZEB1, N-cadherin, and Vimentin in lung metastatic nodules were determined in each group by Western blot. n=6 in each group. *P<0.05.
Abbreviations: CPEB4, cytoplasmic polyadenylation element-binding protein 4; GC, gastric cancer.

Table S1 Primers designed for qRT-PCR

Genes	Sequence (5′–3′)
	Forward	Reverse
CPEB4	TGGGGATCAGCCTCTTCATA	CAATCCGCCTACAAACACCT
E-cadherin	CGAGAGCTACACGTTCACGG	GGGTGTCGAGGGAAAAATAGG
N-cadherin	TCAGGCGTCTGTAGAGGCTT	ATGCACATCCTTCGATAAGACTG
Vimentin	CTGCTTCAAGACTCGGTGGAC	ATCTCCTCCTCGTACAGGTCG
Snail	AAGGCCTTCTCTAGGCCCT	CGCAGGTTGGAGCGGTCAG
Slug	TTCGGACCCACACATTACCT	GCAGTGAGGGCAAGAAAAAG
ZEB1	GATGATGAATGCGAGTCAGATGC	ACAGCAGTGTCTTGTTGTTGT
SIP1	CAAGAGGCGCAAACAAGCC	GGTTGGCAATACCGTCATCC
Twist	CAGCTACGCCTTCTCGGTCT	CTGTCCATTTTCTCCTTCTCTGGA
GAPDH	AGGGGCCATCCACAGTCTTC	AGAAGGCTGGGGCTCATTTG

Abbreviations: CPEB4, cytoplasmic polyadenylation element-binding protein 4; qRT-PCR, quantitative real-time PCR.