Overexpression of long noncoding RNA NORAD in colorectal cancer associates with tumor progression

Figures & data

Table 1 Relationship between NORAD expression and demographic and clinical characteristics of patients with CRC

Characteristics	Cases	Expression level	P-value
	n=60	2^−ΔΔ^C^t
Gender			0.128
Male	34	2.01 (2.52)
Female	26	1.13 (1.57)
Age (years)			0.226
≤60	29	1.28 (1.66)
>60	31	1.97 (2.58)
Tumor location			0.432
Colon	20	1.31 (2.29)
Rectum	40	1.78 (2.15)
Differentiation			0.517
Well	8	0.866 (1.48)
Moderate	39	1.67 (2.12)
Poor	13	1.99 (2.769)
Size (cm)			0.604
≤5	36	1.75 (2.20)
>5	24	1.45 (2.20)
Local invasion			0.014*
T1–T2	27	0.87 (1.19)
T3–T4	33	2.26 (2.61)
Lymph node positive metastasis			0.037*
No	32	1.08 (1.79)
Yes	28	2.26 (2.46)
TNM stages			<0.001*
I	11	0.28 (0.67)
II	23	0.95 (1.52)
III	26	2.81 (2.53)

Notes:

* P<0.05.

Abbreviations: CRC, colorectal cancer; NORAD, noncoding RNA-activated by DNA damage.

Figure 1 High NORAD expression is associated with the progression of tumor development in CRC patients.

Notes: (A) NORAD expression was determined by qPCR, normalized against GAPDH, in 60 paired CRC tissues and adjacent noncancerous tissues; (B) the level of NORAD in TNM stages of CRC; (C) the overexpression of NORAD in CRC was associated with lymph node metastasis; (D) increased levels of NORAD were associated with deeper invasion in CRC. CRC diagnosis was confirmed by histopathological method TNM data, metastases and stage were classified according to the TNM classification.
Abbreviations: CRC, colorectal cancer; NORAD, noncoding RNA-activated by DNA damage; qPCR, quantitative polymerase chain reaction.

Figure 2 Expression levels of NORAD in sera of healthy controls, patients with CRC, and patients with benign diseases.

Notes: (A) The expression level of lncRNA NORAD was significantly higher in the CRC group than in the healthy control group and benign disease group. (B) ROC curve analysis for the detection of CRC using lncRNA NORAD.
Abbreviations: CRC, colorectal cancer; lnc, long noncoding; NORAD, noncoding RNA-activated by DNA damage; ROC, receiver operating characteristic.

Figure 3 Effect of NORAD knockdown on CRC cell viability in vitro.

Notes: (A) Validation of si-NORAD knockdown effect in HCT116 and SW1116. (B and C) Growth curves of si-NC/NORAD-transfected HCT116 and SW1116 CRC cells, respectively, were determined by findings from the CCK-8 assay; (D and E) representative photographs and statistical analyses of the colony formation assay of si-NC/NORAD-transfected CRC cells. *P<0.05.
Abbreviations: CCK, Cell Counting Kit; CRC, colorectal cancer; NC, negative control; NORAD, noncoding RNA-activated by DNA damage.

Figure 4 Effect of NORAD knockdown on CRC cell function determined by Transwell assay.

Notes: (A and B) Downregulation of NORAD significantly inhibited the migration of HCT116 and SW1116 CRC cells, respectively; (C and D) invasion abilities were suppressed in cells transfected with NORAD siRNA. The representative pictures and statistical analyses involved five randomly selected fields (all P<0.001).
Abbreviations: CRC, colorectal cancer; NC, negative control; NORAD, noncoding RNA-activated by DNA damage.

Table S1 Sequences of qPCR primers and siRNAs

qPCR primer name	Sequence, 5′–3′
NORAD (forward)	AGCGAAGTCCCGAACGACGA
NORAD (reverse)	TGGGCATTTCCAACGGGCCAA
GAPDH (forward)	ACCCACTCCTCCACCTTTGAC
GAPDH (reverse)	TGTTGCTGTAGC CAAATTCGTT
siRNA name	Sequence, 5′–3′
si-NORAD (No 1)	GCGGTTGGTCTTCATTCTA
si-NORAD (No 2)	GCTAGTGAATTAGCCTATT
si-NORAD (No 3)	GCTAGTGAATTAGCCTATT

Note: The si-negative control was obtained from Ribobio (Guangzhou China).

Abbreviations: qPCR, Quantitative real-time PCR; siRNA, Small interfering RNA.