TRIM37 promotes cell invasion and metastasis by regulating SIP1-mediated epithelial–mesenchymal transition in gastric cancer

Figures & data

Figure 1 Relative TRIM37 expression in GC tissues and its clinical significances.

Notes: (A, B) qRT-PCR analysis of TRIM37 mRNA expression in GC tumor tissues and paracancerous control tissues. (C) Western blot analysis of TRIM37 protein expression in GC tumor tissues and paracancerous control tissues. (D) Representative IHC images of TRIM37 protein expression in clinical GC samples with or without metastasis and paracancerous control tissues. (E) Quantitative evaluation of TRIM37 protein expression in tumor tissues and paracancerous control tissues on the basis of staining scores. (F) Scatterplots of the average staining scores of TRIM37 expression in patients without or with metastasis. (G) Kaplan–Meier analysis of the correlation between TRIM37 expression and the overall survival of patients with GC. *P<0.05.
Abbreviations: GC, gastric cancer; IHC, immunohistochemistry; qRT-PCR, quantitative reverse transcription polymerase chain reaction; TRIM37, tripartite motif containing 37.

Table 1 Correlation with the clinicopathological features and TRIM37 expression in patients with GC

Features	n	TRIM37		P-value
		Negative	Positive
Age (years)
≥60	80	29	51	0.507
<60	40	17	23
Gender
Male	79	34	45	0.141
Female	41	12	29
Tumor size (cm)
≥5	69	22	47	0.091
<5	51	24	27
Lauren’s classification
Diffuse	30	9	21	0.278
Intestinal	90	37	53
Lymphatic vessel invasion
With	49	15	34	0.148
Without	71	31	40
T stage
T1 + T2	54	30	24	<0.001*
T3 + T4	66	16	50
pTNM stage
I + II	51	28	23	0.001*
III + IV	69	18	51
Lymph node metastasis
With (N1 + N2 + N3)	71	14	57	<0.001*
Without (N0)	49	32	17

Note:

* Mean P<0.05. Bold text represents T stage: P=0.000; pTNM stage: P=0.001; and Lymph node metastasis: P=0.000.

Abbreviations: GC, gastric cancer; TRIM37, tripartite motif containing 37.

Figure 2 Relative TRIM37 protein expressions in GC cells.

Notes: (A) Western blot analysis of relative TRIM37 expression in GC cell lines and normal gastric epithelial GES-1 cells. (B, C) Western blot analysis of TRIM37 expression levels in TRIM37-silencing cells (MKN45 and MGC803) and TRIM37-overexpressing cells (KATO-III and AGS). *P<0.05.
Abbreviations: GC, gastric cancer; TRIM37, tripartite motif containing 37.

Figure 3 Effects of TRIM37 knockdown or overexpression on GC cells migration, invasion in vitro, and metastasis in vivo.

Notes: (A) Representative images of the effects of TRIM37 knockdown or overexpression on the morphology of GC cells. (B) The influences of TRIM37 silencing or overexpression on the migration and invasion abilities of GC cells were measured by transwell assay. (C) The effects of TRIM37 silencing or overexpression on GC cells metastasis in vivo. Metastatic tumor nodules (shown by red arrows). (D) Western blot analysis of expressions of TRIM37, E-cadherin, SIP1, and N-cadherin in lung metastatic nodules. *P<0.05.
Abbreviations: GC, gastric cancer; TRIM37, tripartite motif containing 37.

Figure 4 Effects of TRIM37 knockdown or overexpression on EMT-related markers in GC cells.

Notes: Following TRIM37 silencing or overexpression treatment, qRT-PCR (A), Western blot (B), and immunofluorescence (C) were employed to detect the expressions of EMT-related markers in TRIM37-altered cells, including E-cadherin, N-cadherin, and transcription factors (SIP1, Snail, Slug, ZEB1, and Twist). *P<0.05.
Abbreviations: EMT, epithelial–mesenchymal transition; GC, gastric cancer; qRT-PCR, quantitative reverse transcription polymerase chain reaction; TRIM37, tripartite motif containing 37.

Figure 5 SIP1-dependent mechanism of TRIM37-facilitated GC cells EMT and invasion.

Notes: (A, C) Western blot analysis of the SIP1-dependent mechanism of TRIM37-inducing GC cells EMT. (B, D) Confirmation of the SIP1-dependent mechanism of TRIM37-inducing GC cells invasion by transwell assay. *P<0.05.
Abbreviations: EMT, epithelial–mesenchymal transition; GC, gastric cancer; TRIM37, tripartite motif containing 37.

Table S1 Primers designed for qRT-PCR

Genes	Sequence (5′-3′)
	Sense	Antisense
TRIM37	TCAGCTGTATTAGGCGCTGG	ACTTCTTCTGCCCAACGACA
E-cadherin	CGAGAGCTACACGTTCACGG	GGGTGTCGAGGGAAAAATAGG
SIP1	CAAGAGGCGCAAACAAGCC	GGTTGGCAATACCGTCATCC
Snail	AAGGCCTTCTCTAGGCCCT	CGCAGGTTGGAGCGGTCAG
Slug	TTCGGACCCACACATTACCT	GCAGTGAGGGCAAGAAAAAG
ZEB1	GATGATGAATGCGAGTCAGATGC	ACAGCAGTGTCTTGTTGTTGT
Twist	CAGCTACGCCTTCTCGGTCT	CTGTCCATTTTCTCCTTCTCTGGA
N-cadherin	TCAGGCGTCTGTAGAGGCTT	ATGCACATCCTTCGATAAGACTG
GAPDH	AGGGGCCATCCACAGTCTTC	AGAAGGCTGGGGCTCATTTG

Abbreviation: qRT-PCR, quantitative reverse transcription polymerase chain reaction.