Platelets enhance the ability of bone-marrow mesenchymal stem cells to promote cancer metastasis

Figures & data

Table 1 Primer sequences for the amplification of target genes

Genes	Primer sequence (5′–3′)	Product size (bp)	Annealing temperature (°C)
TGF-β	130	Forward: AGCGACTCGCCAGAGTGGTTA Reverse: GCAGTGTGTTATCCCTGCTGTCA	60
β-actin	256	Forward: CCTGGCACCCAGCACAAT Reverse: GGGCCGGACTCGTCATAC	60

Figure 1 Tumor cells and BM-MSCs induce platelet activation.

Notes: (A) The platelet aggregation rate of platelets co-cultured with SGC-7901-CM or BM-MSCs-CM for 30 minutes (a), 60 minutes (b), 120 minutes (c), and 180 minutes (d). (B) The expression of P-selectin of platelets co-cultured with SGC-7901-CM or BM-MSCs-CM for 120 minutes was detected by flow cytometric analysis. The results are expressed as mean ± SEM. *P<0.05, **P<0.01, ***P<0.001.
Abbreviations: BM-MSC, bone-marrow mesenchymal stem cell; CM, conditioned medium; FITC, fluorescein isothiocyanate; SEM, standard error of the mean; SSC, side scatter.

Figure 2 Platelets induce BM-MSCs transdifferentiation into CAF-like cells by secreting TGF-β.

Notes: (A) The expressions of α-SMA, FAP, and vimentin were detected using Western blotting. (B) The expression of TGF-β was detected using Western blotting and quantitative Real-time PCR (RT-PCR) (C) TGF-β receptor block treatment impaired the increase of CAF-like phenotype in BM-MSCs caused by TGF-β derived from platelets. The results are expressed as mean ± SEM. *P<0.05, **P<0.01, ***P<0.001.
Abbreviations: BM-MSCs, bone-marrow MSCs; CAF, cancer-associated fibroblast; FAP, fibroblast activation protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MSC, mesenchymal stem cell; PLT, platelet; SEM, standard error of the mean; α-SMA, α-smooth muscle actin.

Figure 3 Platelets promote BM-MSCs proliferation and migration.

Notes: (A) The migratory ability of BM-MSCs was analyzed by transwell assay (×200 < scale bar: 50 µm). (B) The proliferation of BM-MSCs was detected by cell counting method after co-incubation with platelets for 24, 48, and 72 hours. The results are expressed as mean ± SEM. *P<0.05, ***P<0.001.
Abbreviations: MSC, mesenchymal stem cell; PLT, platelet; BM-MSCs, bone-marrow MSCs.

Figure 4 Platelets enhanced the effect of BM-MSCs on proliferation and metastasis of tumor cells.

Notes: (A) Platelets enhance the ability of BM-MSCs to promote the proliferation of gastric tumor cells. (B) Platelets enhance the ability of BM-MSCs to angiogenesis (×100, scale bar: 100 µm). (C) BM-MSCs treated with platelets enhance the migration ability of SGC-7901 cells (×200, scale bar: 50 µm). (D) The expression of VEGF, c-Myc, and Sall-4 in SGC-7901 cells with different treatments. The results are expressed as mean ± SEM. *P<0.05, **P<0.01, ***P<0.001.
Abbreviations: CM, conditioned medium; MSC, mesenchymal stem cell; PLT, platelet; VEGF, vascular endothelial growth factor; BM-MSCs, bone-marrow MSCs; SEM, standard error of the mean.

Figure 5 Platelets enhanced the effect of BM-MSCs on tumor progression in vivo.

Notes: (A) Platelets enhance the ability of BM-MSCs to promote gastric cancer transfer in vivo. (B) The supernatants of the BM-MSCs when stimulated by platelets enhance the expression of VEGF, Ki-67, c-Myc, and Sall-4. Black arrows indicate positive cells (×200, scale bar: 50 µm). The results are expressed as mean ± SEM. **P<0.01.
Abbreviations: CM, conditioned medium; MSC, mesenchymal stem cell; PLT, platelet; VEGF, vascular endothelial growth factor; BM-MSCs, bone-marrow MSCs; SEM, standard error of the mean.

Figure S1 Characteristic surface markers of BM-MSCs were detected by flow cytometry analysis.

Abbreviations: BM-MSCs, bone marrow-derived mesenchymal stem cells; FITC, fluorescein isothiocyanate; PE, phycoerythrin.

Figure S2 (A) Platelet aggregation of platelets co-cultured with SGC-7901 cells for 0 hours (a, b) and 2 hours (c, d) was photographed by microscope. (B) Platelet aggregation of platelets co-cultured with BM-MSCs for 0 hours (a, b) and 2 hours (c, d) was photographed by microscope. The magnification of a and c is ×400 (scale bar: 10 µm) and the magnification of b and d is ×200 (scale bar: 20 µm).

Abbreviation: BM-MSCs, bone marrow-derived mesenchymal stem cells.

Figure S3 Cell morphology of BM-MSCs co-cultured with T-platelets for 0 hours (A) and 24 hours (B).

Note: Magnification ×100, scale bar: 40µm.
Abbreviation: BM-MSCs, bone marrow-derived mesenchymal stem cells.