Bioinformatic analysis of miR-4792 regulates Radix Tetrastigma hemsleyani flavone to inhibit proliferation, invasion, and induce apoptosis of A549 cells

Figures & data

Table 1 miRNA alignment of differential transfection groups

Name	Alignment
miRNA NC	UGUGCCUAUGUGAUGAUGUAC
miR-4792 mimics	CGGUGAGCGCUCGCUGGC
miR-4792 inhibitor	GCCAGCGAGCGCUCACCG

Abbreviation: NC, negative control.

Figure 1 A549 cell viability and invasion ability after different treatments.

Notes: (A) A549 cell viability after different treatments. (B) Cell invasion ability of four different A549 cell groups. (C) Cell count of four different A549 cell groups. miRNA NC group: A549 cells transfected with NC miRNA; miR-4792 mimics group: A549 cells transfected with miR-4792 mimics; RTHF + miRNA NC group: A549 cells treated with RTHF after miRNA NC transfection; RTHF + miR-4792 inhibitor group: A549 cells treated with RTHF after miR-4792 inhibitor transfection. **P<0.01 vs miRNA NC group; ^##P<0.01 vs RTHF + miRNA NC group.

Abbreviations: NC, negative control; RTHF, Radix Tetrastigma hemsleyani flavone.

Figure 2 Cell cycle distribution and cell apoptosis of A549 cells after different treatments.

Notes: (A) Cell cycle of A549 cells in the different treatment groups using flow cytometry. (B) Graphical representation of the percentage of cell population in G1, S, and G2 phases. (C) Bivariate frequency distribution of Annexin V-FITC/PI two-parameter flow cytometry of A549 cells in the different treatment groups. (D) The percentage of apoptosis in the different treatment groups of A549 cells. **P<0.01 vs miRNA NC group; ^##P<0.01 vs RTHF + miRNA NC group.

Abbreviations: FITC, fluorescein isothiocyanate; NC, negative control; PI, propidium iodide; RTHF, Radix Tetrastigma hemsleyani flavone.

Figure 3 GO and KEGG enrichment analysis of target genes of miR-4792.

Notes: (A) GO enrichment analysis of target genes of miR-4792, BP, CC, and molecular function. (B) KEGG enrichment analysis of target genes of miR-4792.

Abbreviations: AGE, advanced glycation end products; ALS, amyotrophic lateral sclerosis; BP, biological process; CC, cellular component; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; RAGE, receptor for advanced glycation endproducts; VEGF, vascular endothelial growth factor.

Figure 4 Effect of RTHF on miR-4792-mediated Ca²⁺ concentration and expression of FOXC1.

Notes: (A) Changes in Ca²⁺ concentration in A549 cells in the different treatment groups. (B) Expression of FOXC1 in four different A549 cell groups. **P<0.01 vs miRNA NC group; ^##P<0.01 vs RTHF + miRNA NC group. (C) The relation between Ca²⁺ concentration and expression of FOXC1.

Abbreviations: NC, negative control; RTHF, Radix Tetrastigma hemsleyani flavone.

Table 2 Grayscale analysis of FOXC1 protein in different treatment groups of A549 cells

Protein group	A	B	C	D
FOXC1/GAPDH	0.38	0.08a	0.11a	0.37

Notes: A, miRNA NC group: A549 cells transfected with NC miRNA. B, miR-4792 mimics group: A549 cells transfected with miR-4792 mimics. C, RTHF + miRNA NC group: A549 cells treated with RTHF after transfection by miRNA NC. D, RTHF + miR-4792 inhibitor group: A549 cells treated with RTHF after transfection by miR-4792 inhibitor.

a Expression compared to A (miRNA NC group): P<0.01.

Abbreviations: NC, negative control; RTHF, Radix Tetrastigma hemsleyani flavone.

Figure 5 Effect of RTHF on miR-4792–mediated apoptotic-related proteins and key proteins of MAPK signaling pathways.

Notes: A, miRNA NC group: A549 cells transfected with NC miRNA. B, miR-4792 mimics group: A549 cells transfected with miR-4792 mimics. C, RTHF + miRNA NC group: A549 cells treated with RTHF after miRNA NC transfection. D, RTHF + miR-4792 inhibitor group: A549 cells treated with RTHF after miR-4792 inhibitor transfection.

Abbreviations: NC, negative control; RTHF, Radix Tetrastigma hemsleyani flavone.