The NRF2/KEAP1 Pathway Modulates Nasopharyngeal Carcinoma Cell Radiosensitivity via ROS Elimination

Figures & data

Table 1 The Sequences of NRF2 and KEAP1 shRNA for pLKO.1-Puro-shRNA Containing Lenti-Viruses

Name	Sequence
NRF2-sh1	Forward	GATCCGGCTCCTACTGTGATGTGAAATTTCAAGAGAATTTCACATCACAGTAGGAGCTTTTTTG
	Reverse	AATTCAAAAAAGCTCCTACTGTGATGTGAAATTCTCTTGAAATTTCACATCACAGTAGGAGCCG
NRF2-sh2	Forward	GATCCGCCGGCATTTCACTAAACACAATTCAAGAGATTGTGTTTAGTGAAATGCCGGTTTTTTG
	Reverse	AATTCAAAAAACCGGCATTTCACTAAACACAATCTCTTGAATTGTGTTTAGTGAAATGCCGGCG
KEAP1-sh1	Forward	GATCCGGCGAATGATCACAGCAATGAATTCAAGAGATTCATTGCTGTGATCATTCGCTTTTTTG
	Reverse	AATTCAAAAAAGCGAATGATCACAGCAATGAATCTCTTGAATTCATTGCTGTGATCATTCGCCG
KEAP1-sh2	Forward	GATCCGGCACTGCAAATAACCCATCTTTTCAAGAGAAAGATGGGTTATTTGCAGTGCTTTTTTG
	Reverse	AATTCAAAAAAGCACTGCAAATAACCCATCTTTCTCTTGAAAAGATGGGTTATTTGCAGTGCCG

Figure 1 CNE2 cells are more resistant to radiotherapy than CNE1. (A), CNE1 and CNE2 cells were plated on six-well plates at 400 cells per well. After 24 hours of culture, they received 0 Gy, 2 Gy, 4 Gy, 6 Gy, and 8 Gy radiation. After the replacement with a fresh medium, the cultivation continued for 14 days, and the cells were subjected to crystal violet staining and photographed. (B), CNE1 and CNE2 cells were irradiated with 4 Gy radiation, and the apoptosis rate was detected with flow cytometry 48 hours later. (C), CNE1 and CNE2 cells were plated on 96-well plates, respectively, at 10,000 per well. After 24 hours, they were exposed to 0 Gy and 4 Gy radiation. After another 24 hours, ROS levels were detected. All experiments were repeated three times with similar results. The data are the mean ± SD of values from three experiments. *P< 0.05.

Figure 2 CNE2 cells have higher ROS inhibitory ability. (A), the levels of anti-ROS genes were detected with qPCR. (B), The protein levels of NRF2 were detected with Western blotting. (C), CNE1 and CNE2 cells were exposed to 0 Gy and 4 Gy radiation for 24 hours, and NRF2 protein was detected with immunofluorescence. (D), CNE1 and CNE2 were exposed to 0 Gy and 4 Gy rays, and 24 hours later, cytoplasmic and nuclear proteins were extracted, while NRF2 were detected by Western blotting. (E), CNE1 and CNE2 cells were exposed to 0 Gy and 4 Gy radiation, and NRF2 protein was detected with Western blotting. (F), CNE1 and CNE2 cells were exposed to 0 Gy and 4 Gy radiation, and the mRNA level of anti-ROS genes were detected with qPCR. All experiments were repeated three times with similar results. The data are the mean ± SD of values from three experiments. *P< 0.05.

Figure 3 CNE2 has enhanced sensitivity to radiotherapy with NRF2 knockdown. (A), The CNE2 cells were infected with retroviruses containing NRF2 shRNAs. The efficiency of knockdown was examined with Western blotting. (B), The cell proliferation of NRF2-depleted CNE2 cells was measured with the CCK-8 assay. (C), The CNE2 cells with NRF2 depletion were exposed to 4Gy radiation. 24 hours later total RNA was extracted, and the mRNA level of anti-ROS genes was detected with qPCR. (D), The NRF2–depleted CNE2 cells were exposed to 4 Gy radiation. 24 hours later the level of ROS was detected. (E), The NRF2-depleted CNE2 cells were exposed to 4 Gy radiation. 48 hours later cell apoptosis was detected with flow cytometry. (F), The NRF2-depleted CNE2 cells were plated on six-well plates at 500 cells per well. After 24 hours of culture, they received 4 Gy radiation. After the replacement with fresh medium, the cells were cultured continuously for 14 days and were subjected to crystal violet staining. All experiments were repeated three times with similar results. The data are the mean ± SD of values from three experiments. *P< 0.05.

Figure 4 KEAP1 depletion reduces the radiosensitivity of the cells. (A), The levels of KEAP1 in CNE1 and CNE2 cells were detected with Western blotting. (B), The CNE1 and CNE2 cells were exposed to 0 Gy and 4 Gy radiation, and proteins were extracted at the indicated time. KEAP1 protein was subsequently detected with Western blotting. (C), The CNE2 cells were infected with retroviruses containing KEAP1 shRNAs. The efficiency of knockdown was detected with Western blotting. (D), Cell proliferation of KEAP1-depleted CNE2 cells was measured with the CCK-8 assay. (E), The KEAP1–depleted CNE2 cells were exposed to 4Gy radiation. 24 hours later total RNA was extracted, and the mRNA levels of anti-ROS genes were detected with qPCR. (F), The KEAP1–depleted CNE2 cells were exposed to 4Gy radiation. 24 hours later the ROS level was measured. (G), The KEAP1 RNAi CNE2 cells were exposed to 4 Gy radiation. 48 hours later cell apoptosis was detected with flow cytometry. (H), The KEAP1-depleted CNE2 cells were plated on six-well plates at 300 cells per well. After 24 hours of culture, they received 4 Gy radiation. After the replacement with fresh medium, the cells were cultured continuously for 14 days and were subjected to crystal violet staining. All experiments were repeated three times with similar results. The data are the mean ± SD of values from three experiments. *P< 0.05.

Figure 5 The proposed mechanism underlying NRF2 regulation of cellular radiosensitivity. NRF2 binds to KEAP1 in the cytoplasm and is ubiquitinated for further degradation. After irradiation, the KEAP1 level is reduced, resulting in reduced degradation and increased accumulation of NRF2 in the nuclei. As a result, the expression of the anti-ROS genes downstream of NRF2 is up-regulated, leading to the reduction of ROS, cell apoptosis, and ultimately the radiosensitivity of the cells.