Expression and Diagnostic Value of tRNA-Derived Fragments Secreted by Extracellular Vesicles in Hypopharyngeal Carcinoma

Figures & data

Figure 1 The specific operation process of extracellular vesicles extraction.

Table 1 The Basic Informations of tRNAs in Quantitative Real-Time PCR

tRF ID	tRF Type	MINTbase ID	Length	Fold Change	P value
tRF-1:30-Lys-CTT-1-M2	tRF-5c	tRF-30-PSQP4PW3FJIK	30	5.76	0.036
tRF-1:30-Lys-CTT-2-M2	tRF-5c	tRF-30-PSQP4PW3FJI0	30	4.45	0.025
tRF-60:76-Lys-CTT-1-M4	tRF-3a	tRF-17-K6MY6V2	17	−1.98	0.033

Figure 2 Identification of extracellular vesicles in hypopharyngeal cancer patients and healthy subjects. (A and B) SEM of extracellular vesicles (200nm) in healthy subjects and hypopharyngeal cancer patients, respectively. (C and D) SEM of extracellular vesicles (500nm) in healthy subjects and hypopharyngeal cancer patients, respectively.

Table 2 The Primer Sequence of tRNAs in Quantitative Real-Time PCR

	Primer Sequence
tRF-1:30-Lys-CTT-1-M2	F:5ʹGTTCCGGCTAGCTCAGTCGTT3ʹ R:5ʹCATTGTAGAGCATGGGAATCA3’
tRF-1:30-Lys-CTT-2-M2	F:5ʹGTCCGGCTAGCTCAGTCGTCTTAGA3ʹ R:5ʹCAGTAGAGCATGAGGCTCGCACCAT3’
tRF-60:76-Lys-CTT-1-M4	F:5ʹATACTGTAAAGCTAACTCTCCA3ʹ R:5ʹTCGTAGCATTAACCTTCATCCA3’

Figure 3 Sequencing of tRFs. (A) Heat map analysis of tRFs, with 5 samples chosen from groups N and NT, respectively, for sequencing. N is the control group (healthy subjects), and NT is the experimental group (treatment-naive and non-lung metastatic hypopharyngeal cancer patients). (B) Expressions of tRF-1:30-Lys-CTT-1-M2, tRF-1:30-Lys-CTT-2-M2 and tRF-60:76-Lys-CTT-1-M4 in the human normal laryngeal epithelial cell and hypopharyngeal cancer cell (FaDu), respectively. ***Means that compared with human normal laryngeal epithelial cellS, the expression of tRF-1:30-Lys-CTT-1-M2 in FaDu cells is significantly increased, and the difference is statistically significant.

Figure 4 Subtype analysis of tRFs. (A and B) Subtype analysis of extracellular vesicles tRFs in the healthy subjects and hypopharyngeal cancer patients, respectively. (C and D) The length distribution of each tRFs subtype in healthy individuals and hypopharyngeal cancer patients, respectively. N is the control group (healthy subjects), and NT is the experimental group (treatment-naive and non-lung metastatic hypopharyngeal cancer patients).

Figure 5 Expressions of tRFs in the treatment-naive and non-lung metastatic hypopharyngeal cancer patients. (A–C) Extracellular vesicles expressions of tRF-1:30-Lys-CTT-1-M2, tRF-1:30-Lys-CTT-2-M2, and tRF-60:76-Lys-CTT-1-M4 in the treatment-naive and non-lung metastatic hypopharyngeal cancer patients and healthy subjects, respectively. ***Means that compared with healthy subjects, the expression of tRF-1:30-Lys-CTT-1-M2 in newly diagnosed patients is significantly increased, and the difference is statistically significant.

Table 3 Correlation Analysis Between the Expression Level of tRNA Fragment and Its Clinicopathological Characteristics in 30 Newly Diagnosed and Newly Treated HNC Patients

Characteristics	N=30	tRF-1:30-Lys-CTT-1-M2		P value
		High Expression (%)	Low Expression (%)
Age (years)				0.313
<50	12	7 (58.3)	5 (41.6)
≥50	18	8 (44.5)	10 (55.5)
Gander				0.254
Male	25	11 (44)	14 (56)
Female	5	3 (60.0)	2 (40.0)
Tumor stage				<0.01
I+II	14	5 (35.7)	9 (64.3)
III+IV	16	12 (75.0)	4 (25.0)
Tumor differentiation				<0.01
Well	9	2 (22.2)	7 (77.8)
Moderate	13	10 (76.9)	3 (23.1)
Poor	8	6 (75)	2 (25)
Smoking history				<0.01
Yes	13	5 (38.5)	8 (61.5)
No	17	11 (64.7)	6 (35.5)
Drinking history				<0.01
Yes	19	13 (68.4)	6 (31.6)
No	11	3 (27.3)	8 (72.7)
Tumor site				0.277
Postcricoid region	9	5 (55.6)	4 (44.4)
Postrior Pharyngeal Wall	11	6 (54.5)	5 (45.5)
Piriform sinus	10	4 (40.0)	6 (60.0)

Table 4 The Relationship Between the Expression Level of tRNA Fragments and the Clinicopathological Characteristics of 30 Patients with HNC Lung Metastasis

Characteristics	N=30	tRF-1:30-Lys-CTT-1-M2 Expression (Mean±SD)	P value
Age (years)			0.365
<50	14	1.571±0.219
≥50	16	1.634±0.324
Gander			0.514
Male	28	1.554±0.632
Female	2	1.650±0.551
Tumor stage			<0.05
I+II	16	1.279±0.783
III+IV	14	1.882±0.911
Tumor differentiation			<0.05
Well	9	1.003±0.405
Moderate	13	1.619±1.011
Poor	8	1.992±1.073
Smoking history			<0.05
Yes	17	1.832±1.098
No	13	1.117±0.793
Drinking history			<0.01
Yes	16	1.723±0.823
No	14	1.022±0.401
Tumor site			0.118
Postcricoid region	8	1.032±0.413
Postrior Pharyngeal Wall	12	1.277±0.735
Piriform sinus	10	1.392±0.982

Figure 6 Analysis of the diagnostic value of tRFs. (A–C) ROC curve analysis of tRF-1:30-Lys-CTT-1-M2, tRF-1:30-Lys-CTT-2-M2, and tRF-60:76-Lys-CTT-1-M4 in hypopharyngeal cancer patients, respectively. (D) Expressions of tRF-1:30-Lys-CTT-1-M2 in the lung metastatic and non-lung metastatic patients. ***Means that compared with metastatic patients, the expression of tRF-1:30-Lys-CTT-1-M2 in newly diagnosed patients is significantly decreased, and the difference is statistically significant.

Table 5 Univariate and Multivariate Cox Regression Analysis of Risk Factors for Patients with HNC Metastasis

Parameter	Univariate			Multivariate
	HR	95% CI	P value	HR	95% CI	P value
Age	0.844	(0.487–1.219)	0.212
Gander	0.737	(0.512–1.102)	0.327
Tumor stage	1.297	(0.833–1.973)	0.028	1.533	(0.749–2.072)	0.016
Tumor differentiation	1.521	(1.172–2.429)	0.020	1.322	(0.870–1.773)	0.069
Smoking history	1.312	(0.628–1.927)	0.015	1.645	(0.771–2.098)	0.026
Drinking history	1.351	(0.793–2.012)	0.027	1.556	(0.992–2.174)	0.025
Tumor site	0.901	(0.403–1.194)	0.501
tRF-1:30-Lys-CTT-1-M2	3.459	(2.252–4.173)	<0.001	3.398	(1.723–4.472)	<0.001