Next-Generation Sequencing and Bioinformatics-Based Protocol for the Full-Length CYP2E1 Gene Polymorphism Analysis

Figures & data

Table 1 Primer Sequences for the Full-Length CYP2E1 Gene Amplification

Primer Name	Sequence (5’-3’)	Position in the Reference Genome*	Product Size (bp)
2E1_1_Fw	ACATTGTGAGACAGTGTTTTCTTCT	133524910-133524934	2059
2E1_1_Rw	ATGCCGACCACCTCTAGACA	133526949-133526968
2E1_2_Fw	CCGGGATCAACAAAGACAAGAT	133526549-133526570	3820
2E1_2_Rw	ACATCCCGAGATGACCCATTT	133530348-133530368
2E1_3_Fw	TCCAGAACCTTGTCTCCGGA	133529778-133529797	2290
2E1_3_Fw	TGCTCAGTCACCCACTGAG	133532049-133532067
2E1_4_Fw	TTACCGCAGAATGCCCAGAG	133530647-133530666	3381
2E1_4_Fw	GCCATCTCACCACATCACCA	133534008-133534027
2E1_5_Fw	TTCCTATGGCTTGTGGCTCA	133533322-133533341	3002
2E1_5_Rw	TCCCCAGGTCCTTTGAATTACTG	133536301-133536323
2E1_6_Fw	GCACTAGGGGAACCATGGAAT	133535579-133535599	2119
2E1_6_Rw	CATCTGGAAACCCCCAGTGA	133537678-133537697
2E1_7_Fw	ACTGCTTAGGATGCTCCAT	133536333-133536351	2836
2E1_7_Rw	CTGTGAGAATCACTTAAACAAT	133539146-133539167

Note: *Human reference genome (GRCh38.p13, GCF_000001405.39).

Figure 1 Graphical representation of the PCR fragment position in the reference CYP2E1 gene. The exons are indicated by green boxes. Names of the seven primer pairs used to generate the PCR fragments are indicated.

Abbreviations: Fw, forward; Rw, reverse; K, thousand.

Table 2 Sequencing Data Quality for the Study Sample Set (n = 3)

Patient ID	Number of Reads Mapped	Average Read Length, bp	Mean Read Base Quality Score	Mean Mapped Read Depth	≥Tenfold Coverage*	No Coverage**
30	74,943	162	37.8	255	99.20%	0.06%
32	79,585	158	37.8	263	99.00%	0.07%
33	64,975	166	37.8	283	98.20%	0.02%

Notes: *Percentage of the target fragment (11,761 bp) with at least tenfold coverage, genomic coordinates chr10:133527363-133539123. **Percentage of the target fragment (11,761 bp) with zero coverage, genomic coordinates chr10:133527363-133539123.

Figure 2 Visualization of PCR products of the seven primer pairs amplifying full-length CYP2E1 gene for the test samples (n=3) by agarose gel electrophoresis. (A) PCR products of the primer pairs Nr. 1, 2 and 3. (B) PCR products of the primer pair Nr. 4. (C) PCR products of the primer pairs Nr. 5, 6 and 7. Names of the primer pairs used to generate the PCR fragments are indicated. M – DNA molecular weight marker GeneRuler 1 kb DNA ladder (Thermo Fisher Scientific Baltics, UAB, Lithuania); size of the three reference bands (6000, 3000 and 1000 bp) is indicated; 30, 32 and 33 – test DNA samples.

Abbreviations: Fw, forward; Rw, reverseNC, negative control.

Table 3 Classification of the Identified Single Nucleotide Variants

Sample ID	Intronic Variants	Exonic Variants	3` UTR Variants	Upstream	Intergenic	Total
30	38	0	2	0	0	40
32	27	1	3	2	5	38
33	22	0	2	0	0	24