Microarray Expression Profile and Bioinformatic Analysis of Circular RNA in Human Arteriosclerosis Obliterans

Figures & data

Figure 1 Analytical process of this study.

Table 1 The Most Significantly 5 Up-Regulated and 5 Down-Regulated circRNAs (Raw Density of the Normal Group ≥200) in Microarray Analysis

ID	NC Readcount	ASO Readcount	Log2FC	Pavl	Padj
hsa_circ_0044097	1912.5	507.166667	4.0372972	0.001255	0.0139375
hsa_circ_0003266	1295.666667	417.166667	3.6559456	0.0008921	0.0130497
hsa_circ_0118936	1061.666667	333.666667	3.648185	0.0153102	0.0434825
hsa_circ_0092303	4272.333333	1250.666667	3.1383759	0.0086705	0.0309818
hsa_circ_0067161	1372.666667	514.333333	3.0774146	0.0001848	0.0096161
hsa_circ_0091934	380	8823.833333	29.338455	0.0002999	0.0110373
hsa_circ_0050900	349.166667	7802.666667	27.267452	0.001487	0.0145583
hsa_circ_0007386	147	4375.5	27.167938	0.0005477	0.0117977
hsa_circ_0050898	983.333333	18,144.83333	26.551027	0.0009403	0.0131719
hsa_circ_0092022	192	4946.833333	25.854846	0.0004893	0.0116737

Table 2 The Primer Sequences Used for RT-qPCR (from 5’ to 3’)

Gene		Sequence 5’- 3’
hsa_circ_0044097	Forward	CTGATCTCCGGACTCACACC
	Reverse	CCTTCTCAAGAGGCTCAGCA
hsa_circ_0003266	Forward	GCTGCTTCATCACATGTCGT
	Reverse	GCAAGTCCTCAAAACCAGCA
hsa_circ_0118936	Forward	TGTATCTCCAGGGCAGCTTACT
	Reverse	TTGGATGGTCAGAAGGGTTTG
hsa_circ_0092303	Forward	CATCATCACAGCCCCTCCC
	Reverse	ACTTCCCACTTAAGCCCCTC
hsa_circ_0067161	Forward	ACCCAGGGTCCGGTACTG
	Reverse	AGGAAGAGCACATTGGGGAT
hsa_circ_0091934	Forward	GGAGAATGAGGACGGCACTT
	Reverse	CCTTCGGGATCCGTCACTT
hsa_circ_0050900	Forward	ATACCTCGACATCCCCAAGA
	Reverse	TGTTCTCGATCTGTGTGCCT
hsa_circ_0007386	Forward	GTTGCTGTACTTTGCCAACAA
	Reverse	ACGTGGAGAGAACTGGACTT
hsa_circ_0050898	Forward	AGGTCTTAGCAGGGGACAA
	Reverse	TAGTCCACCATTCCGCCG
hsa_circ_0092022	Forward	ATCGCCAACAAGACCACCTA
	Reverse	TAAAGTCGCAGGCACCTAGG
GAPDH	Forward	ACAACTTTGGTATCGTGGAAGG
	Reverse	GCCATCACGCCACAGTTTC

Figure 2 (A and B) The histopathology features of HE and EVG stained normal and ASO arterial tissues sections. (C) Medial elastin destruction was graded as I (mild) to IV (severe).

Notes: Scale bar = 100 and 200 μm. Nonparametric Mann–Whitney test, *p < 0.05 NC vs ASO, n=3/group. EVG, Verhoeff’s Van Gieson.

Figure 3 Differentially expressed circRNAs between normal and ASO arterial tissues.

Notes: (A) Heat map showed the DE circRNAs in normal and ASO arterial tissues. The circRNA-seq samples (X-axis) were hierarchically clustered based on expression similarity profiles at the top. On the left (Y-axis) means DE circRNAs, which were clustered based on the expression similarity. Colour differed from green to red with green denoting relatively downregulated expression and red representing relatively up-expressed circRNAs. (B) Volcano plot exhibits the DE circRNAs in normal and ASO arterial tissues. The log2 fold-change of circRNA expression between the ASO and normal group was represented on the X-axis, and the statistically significant degree of various circRNA expression change was represented on the Y-axis. Each scattered box in the plot represented the expression value for each circRNA, the gray boxes meant no significant difference of circRNAs expression, and the red boxes represented the significantly expressed circRNAs.

Figure 4 The results of GO and KEGG analysis.

Notes: (A) The top 10 GO terms of DE circRNA host genes at three gene ontology levels (biological processes, molecular function and cell component). (B) The top 10 signal pathways of KEGG pathway enrichment analysis. The enrichment score of each pathway was represented on X-axis while the pathway name was represented on Y-axis. The size of the dots reflected the selection counts, and the color was consistent with the different p value ranges.

Figure 5 Validation of microarray assay results by RT-qPCR of 10 selected circRNAs (the top 5 upregulated and 5 downregulated circRNAs, raw density of the normal group ≥200).

Notes: Sequencing-detected changes of the 10 selected circRNAs were confirmed using RT -qPCR in the normal and ASO arterial tissue groups (n = 3). Bars show means ± standard deviation. Bars show the mean and error bars the standard deviation. *p < 0.05 NC vs ASO.

Figure 6 The construction of circRNA-miRNA-mRNA network.

Notes: Based on the ceRNA (circRNA-miRNA-mRNA) interaction information from Cytoscape, 5 validated and consistent circRNAs (hsa_circ_0003266, hsa_circ_0118936, hsa_circ_0067161, hsa_circ_0091934 and hsa_circ_0092022) were annotated in detail. According to the prediction outcome of miRNA and mRNA, the top 5 miRNAs may be regulated by these 5 validated circRNAs, and the top 50 target genes of each miRNA were presented. Brown: circRNAs. Red: miRNAs. Blue: mRNAs.

Data Sharing Statement

The dataset of the raw and processed sequencing data originated from this study is freely available from the online repositories: National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database (GSE152280).