Lack of association with high myopia and the MYP2 locus in the Japanese population by high resolution microsatellite analysis on chromosome 18

Figures & data

Figure 1 Shows p values by Fisher’s exact test based on 2 × 2 contingency tables (Red circles) or on 2 × m contingency tables (Blue circles) in the first screening. Blue line indicate p values = 0.05.

Table 1 Three step screening of pooled DNA method

Registration ID	5′primer sequence	p-values
	3′primer sequence	1st		2nd		3rd
		2 × 2	2 × m	2 × 2	2 × m	2 × 2	2 × m
D18S0356i	TCTTCAATAAGCAACTGAATCT CCTAAATGAATTCATAACCTAGTTT	0.0204802	0.0186256	0.0200699	0.0407851	0.00827632	0.00552037
D18S0201i	CAGAGCTTAGTCATGTCAAGAC ATTAGTTATTCTGAAGTTGCTT	0.00164119	0.0392785	0.0000000017854	0.000000213675	0.0000742732	0.00767778
D18S0301i	GAGTAAAGCTAGGATCCAAGAG AGTAAACTTCTGATCCAATCCT	0.0155871	0.0155871	0.000038454	0.000038454	0.0256271	0.0256271
D18S0357i	GAGCTTACAGTCAGCTGAGAT CAGGTGACAATTTATATAGCTGAT	0.000000568913	0.000000953615	0.0318655	0.0418926	0.0255968	0.0604102

p values were calculated by Fisher’s exact test, based on 2 × 2 and 2 × m contingency tables with estimated allele frequencies. The smallest P value was selected

Table 2 Statistical significance of alleles associated with high myopia on chromosome 18

Registration ID	No. of alleles	Allele amplicon size	Allele frequencies		p-values	OR	95%CI
			Patient	Control
D18S0356i	7	431	0.040	0.032	0.4486
		435	0.006	0.002	0.4522
		439	0.324	0.333	0.7246
		443	0.376	0.412	0.1335
		447	0.219	0.188	0.1127
		451	0.034	0.031	0.8939
		455	0.001	0.001	1
D18S0201i	10	401	0.017	0.017	1
		427	0.000	0.002	0.4997
		429	0.010	0.003	0.0894
		431	0.351	0.379	0.231
		433	0.069	0.051	0.1274
		435	0.271	0.272	0.9569
		437	0.207	0.186	0.3036
		439	0.045	0.043	0.815
		441	0.028	0.041	0.1482
		443	0.001	0.005	0.3743
D18S0301i	4	458	0.000	0.001	0.4994
		461	0.033	0.054	0.0376	0.61	0.383–0.973
		464	0.962	0.943	0.0596
		467	0.004	0.002	0.687

p values were calculated by Fisher’s exact test, based on 2 × 2 contingency tables.