Lipid-soluble cigarette smoking particles induce expression of inflammatory and extracellular-matrix-related genes in rat cerebral arteries

Figures & data

Table 1 Gene-specific primer sequences and accession numbers

Gene name	Abbreviation	Accession number	Primer sequence
Beta-actin	β-actin	NM-031144	gtagccatccaggctgtgttg tgccagtggtacgaccagag
Elongating factor 1	EF-1	NM-175838	gcaagcccatgtgtgttgaa tgatgacacccacagcaactg
Interleukin 6	IL6	NM-012589	aagagacttccagccagttgcc actggtctgttgtgggtggtatc
Inducible no synthase	iNOS	NM-012611	caatggcttgaggcagaagc gccacctcggatatctcttgc
Matrix metalloproteinase 9	MMP9	NM-031055	aagccttggtgtggcacgac tggaaatacgcagggtttgc
Matrix metalloproteinase 13	MMP13	M60616	tctgcaccctcagcaggttg catgaggtctcgggatggatg
Angiotensin II receptor 1	AT1	NM-030985	ggtggagtgacaggttcaaagc agggtgaatggtcctttggtc
Angiotensin II receptor 2	AT2	U01908	tctgttagtgggatgcatgtaatca tgtgggcctccaaaccatt

Figure 1 The expression of the inflammatory genes tended to be greater in the cerebral arteries treated with DSP than in the cerebral arteries treated with DMSO control. There was a significant upregulation of the extracellular-matrix-related genes (MMP9 and MMP13) in the DSP group, compared with DMSO control. The cerebral arteries have been organ cultured for 24 hours in the presence of DSP or DMSO (control).

Notes: Data presented as mean ± SEM, n = 4; *p < 0.05.
Abbreviations: DMSO, dimethyl sulfoxide; DSP, cigarette smoke particles; MMP, matrix metalloproteinase; ns, not significant.

Figure 2 The expression of angiotensin II receptors in the cerebral arteries following organ culture with DSP or DMSO (control), there was a significant upregulation of the AT₁ receptors induced by DSP compared with DMSO.

Notes: Data presented as mean ± SEM, n = 4; *p < 0.05.
Abbreviations: AT, angiotensin receptor; DMSO, dimethyl sulfoxide; DSP, cigarette smoke particles; ns, not significant.

Figure 3 No p38 phosphorylation was found in the fresh cerebral arteries, while a slight increase was obtained in the cerebral arteries treated with DMSO and a strong activation in the cerebral arteries treated with DSP, ATF-2 and Elk-1 showed the same pattern as the p38 phosphorylation. However, phosphorylation of Elk-1 was also seen in the fresh cerebral arteries.

Abbreviations: DMSO, dimethyl sulfoxide; DSP, cigarette smoke particles.

Table 2 Phosphorylation of intracellular signal proteins induced by DSP

	Fresh	DMSO-treated	DSP-treated
p-p38	1 ± 0.26	1.15 ± 0.38	1.81 ± 0.26*
p-ERK 1/2	1 ± 0.18	1.58 ± 0.13	1.83 ± 0.40
p-SAPK/JNK	1 ± 0.03	1.51 ± 0.34	1.79 ± 0.09
p-ATF-2	1 ± 0.12	1.14 ± 0.09	1.61 ± 0.37*
p-Elk-1	1 ± 0.19	1.08 ± 0.54	2.18 ± 0.09*
p-c-Jun	1 ± 0.49	1.81 ± 0.25	1.88 ± 0.27

Notes: Data presented as mean ± SEM, n = 4;

* p < 0.05 when comparing DSP with DMSO control.

Abbreviations: DMSO, dimethyl sulfoxide; DSP, cigarette smoke particles.

Figure 4 Immunohistochemistry shows a significant increase in the amount of phosphorylated MMP13 proteins and AT₁ receptor proteins in the cerebral arteries treated with DSP, compared with the control (DMSO-treated cerebral arteries). However, there was no increase in AT₂ receptor proteins induced by DSP.

Notes: The size marker represents 20 μm.
Abbreviations: AT, angiotensin receptor; DMSO, dimethyl sulfoxide; DSP, cigarette smoke particles; MMP, matrix metalloproteinase.