Effect of Methotrexate/Vitamin B₁₂ on DNA Methylation as a Potential Factor in Leukemia Treatment-Related Neurotoxicity

Figures & data

Figure 1. Summary diagram of the main pathways involved in cellular one-carbon metabolism including the production of S-adenosylmethionine for methylation of DNA.

Dietary factors able to influence this pathway are highlighted in red, enzymes driving biological reactions are highlighted in blue/bold. The influence of methotrexate on this pathway through the inhibition of dihydrofolate reductase enzyme is highlighted in red/italics. Additional abbreviations: DHF, THF, SHMT, MTRR, MTHFR, BHMT, CBS, COMT, DNMT, SAH.

BHMT: Betaine-homocysteine S-methyltransferase; CBS: Cystathione beta synthase; COMT: cystathionine beta synthase; DHF: Dihydrofolate; DHFR: Dihydrofolate reductase; DNMT: DNA methyltransferase; MTHFR: Methylenetetrahydrofolate reductase; MTRR: Methionine synthase reductase; MTX: Methotrexate; SAH: S-adenosylhomocysteine; SAM: S-adenosylmethionine; SHMT: Serine hydroxymethyltransferase; THF: Tetrahydrofolate.

Modified with permission from [1] (2011).

Figure 2. Schema depicting 3 × 3 factorial study design.

The experiment was carried out in triplicate for each cell line, resulting in an n = 9 per group to investigate the main effects of MTX and vitamin B₁₂ treatments alone, and n = 3 to investigate the interaction between treatments.

MTX: Methotrexate.

Table 1. Primer sequences and PCR and Pyrosequencing^® conditions.

Gene	Forward primer	Reverse primer	PCR					Pyrosequencing	Ref.
			PCR Volume (μl)	Primer Concentration (ng)	Size (bp)	Annealing (°C)	Magnesium (μl)	Sequencing primer
LINE1	TTTTGAGTTAGGTGTGGGATATA	Biotin-AAAATCAAAAAATTCCCTTTC	20	10	168	50	0	AGTTAGGTGTGGGATATAGT	[16]
HOXA4	TACACTTCACAAATTAATAACCATAAACTC	Biotin -GTTGTTGTAGYGGTAGGTGTTG	25	75	188	63	1.5	AACCCAAATTCCCTCCCTT	[17]
FKBP5	ATTTGTAGTTGGGATAATAATTTGG	Biotin-AAATAAAATACAACTTTTCAAAACTAA	25	75	240	58	1.5	TGGAGTTATAGTGTAGGTTTT

Figure 3. Effect of (A) MTX treatment (B) vitamin B₁₂ concentration and (C) interaction between treatments on proliferation of DAOY, SH-SY5Y and MO3.13 cells 4 days after seeding.

Cells were seeded in T25 cm² flasks at the following starting densities (total cell number): MO3.13 and DAOY; 1 × 10⁵ - SH-SY5Y - 2 × 10⁵. Data were analyzed using univariate ANOVA, n = 9 per treatment group for main effects (i.e., MTX and vitamin B₁₂ treatments) and n = 3 for interaction, error bars represent 95% CIs. P-values relate to effect of treatment on methylation; where groups do not share the same letter post hoc tests revealed significant differences (p > 0.05).

MTX: Methotrexate.

Figure 4. Effect of MTX treatment on (A) LINE1 (B) HOXA4 and (C) FKBP5 DNA methylation in DAOY, SH-SY5Y and MO3.13 cells. Data were analyzed using univariate ANOVA, n = 9 per treatment group*, error bars represent 95% CIs. P-values relate to effect of treatment on methylation; where groups do not share the same letter post hoc tests revealed significant differences (p > 0.05). (*with the exception of HOXA4 methylation in MO3.13 cells where n = 7, 9 and 8 respectively for 0, 1 and 5 μM MTX groups).

MTX: Methotrexate.

Table 2. Methylation at all investigated loci in response to vitamin B₁₂ treatment in DAOY, SH-SY5Y and MO3.13 cells.

	Vitamin B12 concentration (ng/ml)			Pooled SEM	p-value
	0	1	10
DAOY
Mean LINE1 methylation	40.67	40.97	40.72	0.164	0.414
Mean HOXA4 methylation	3.92	3.79	3.63	0.255	0.731
Mean FKBP5 methylation	81.00	84.15	83.10	1.205	0.198
SH-SY5Y
Mean LINE1 methylation	78.25	78.43	78.20	0.363	0.899
Mean HOXA4 methylation*	88.90^a	89.20^ab	90.03^b	0.588	0.029
Mean FKBP5 methylation	91.34	90.39	89.42	1.159	0.514
MO3.13
Mean LINE1 methylation	77.22	77.09	76.73	0.272	0.436
Mean HOXA4 methylation	30.57	29.36	31.07	1.35	0.662
Mean FKBP5 methylation	92.55	92.31	92.73	0.569	0.873

Data were analyzed using univariate ANOVA, n = 9 or 8* per treatment group. P-values relate to effect of treatment on methylation; where groups do not share the same letter post hoc tests revealed significant differences (p > 0.05).

SEM: Standard error of the mean.

Figure 5. Mean LINE1 methylation of DAOY treated with various concentrations of methotrexate and vitamin B₁₂.

n = 3 per treatment group. Data were analyzed using univariate ANOVA, p = 0.038 for interaction between MTX and vitamin B₁₂ treatments. Error bars represent 95% CIs.

MTX: Methotrexate.

Mckay JA , MathersJC . Diet induced epigenetic changes and their implications for health . Acta Physiol. (Oxf.)202 ( 2 ), 103 – 118 ( 2011 ).

 PubMed Web of Science ®Google Scholar

Bollati V , BaccarelliA , HouLet al. Changes in DNA methylation patterns in subjects exposed to low-dose benzene . Cancer Res.67 ( 3 ), 876 – 880 ( 2007 ).

 PubMed Web of Science ®Google Scholar

Strathdee G , SimA , ParkerA , OscierD , BrownR . Promoter hypermethylation silences expression of the HoxA4 gene and correlates with IgVh mutational status in CLL . Leukemia20 ( 7 ), 1326 – 1329 ( 2006 ).

 PubMed Web of Science ®Google Scholar