Analysis of miRNA Expression Profiling Identifies miR-214-3p as a Novel Biomarker in Sinonasal Inverted Papilloma

Figures & data

Table 1.  Characteristics of 32 patients with sinonasal inverted papilloma.

Characteristic	n
Age:
– <50 years	11
– ≥50 years	21
Gender:
– Male	26
– Female	6
Smoking status:
– Yes	21
– No	11
Tumor staging:^†
– I	5
– II	17
– III	8
– IV	2
– I+II	22
– III+IV	10
Recurrence:
– Yes	4
– No	28

^†Tumor staging is defined according to a staging system for inverted papilloma described by Krouse (2000).

Table 2.  Primer sequences used for quantitative real-time reverse transcription PCR.

Symbol	Primer (5′ to 3′)
miR-205-3p	GGGATTTCAGTGGAGTGTAGTTC
miR-429	GGTAATACTGTCTGGTAAAAGCGT
miR-148a-3p	TCAGTGCACTACAGAACTTGGTAA
miR-193b-3p	GCCCTCAAAGTCCCGCTA
miR-218-5p	TTGTGCTTGATCTAACCATGTAAA
miR-449b-5p	AGGCAGTGTATTGTTAGCTAGCA
miR-431-3p	CAGGTCGTCTTGCAGGGCTA
miR-214-3p	ACAGCAGGCACAGACAGGA
miR-133b	GTCCCCTTCAACCAGCTAAA
U6	TTCGTGAAGCGTTCCATATTTT

Figure 1.  Hierarchical clustering of miRNA expression profiles.

A hierarchical cluster analysis was performed with 58 differentially expressed miRNAs as compared the SNIP tissues from the SNIP group (n = 5) with nontumorous tissues from the control group (n = 5; fold change >3; p < 0.01). Each row indicates one miRNA, and each column indicates one sample. The miRNA expression levels are illustrated using a color key and histogram. The red and green bars denote high and low expression, respectively.

Table 3.  List of differentially expressed miRNAs in sinonasal inverted papilloma tissues detected by miRNA microarray assay.

Upregulated miRNAs				Downregulated miRNAs
miRNA	Accession no.	log2 fold change	p-value	miRNA	Accession no.	log2 fold change	p-value
miR-205-3p	MIMAT0009197	7.026609	1.51E-05	miR-133a-3p	MIMAT0000427	-6.3399	1.61E-05
miR-203a-3p	MIMAT0000264	6.336157	1.34E-06	miR-1-3p	MIMAT0000416	-6.33986	0.000979
miR-31-3p	MIMAT0004504	5.752372	0.001156	miR-133b	MIMAT0000770	-5.92231	0.000851
miR-141-5p	MIMAT0004598	5.217086	0.000351	miR-143-5p	MIMAT0004599	-4.57649	0.003366
miR-449b-5p	MIMAT0003327	4.906202	0.002795	miR-218-5p	MIMAT0000275	-4.26118	0.007145
miR-31-5p	MIMAT0000089	4.878043	1.23E-05	miR-145-5p	MIMAT0000437	-4.05961	5.57E-05
miR-431-3p	MIMAT0004757	4.550118	0.000205	miR-143-3p	MIMAT0000435	-3.85758	0.000158
miR-224-3p	MIMAT0009198	4.350782	0.001101	miR-146a-5p	MIMAT0000449	-3.33842	0.000261
miR-205-5p	MIMAT0000266	3.664981	0.000119	miR-451a	MIMAT0001631	-3.01357	0.006868
miR-34c-5p	MIMAT0000686	3.465611	0.005837	miR-125b-5p	MIMAT0000423	-2.77412	0.003688
miR-210-3p	MIMAT0000267	3.42754	1.20E-06	miR-100-5p	MIMAT0000098	-2.73567	0.004155
miR-223-3p	MIMAT0000280	3.220448	8.71E-06	miR-193b-3p	MIMAT0002819	-2.1396	0.004684
miR-34b-5p	MIMAT0000685	3.174226	0.00418	miR-148a-3p	MIMAT0000243	-2.05114	0.000909
miR-378d	MIMAT0018926	2.990037	0.000275	miR-195-5p	MIMAT0000461	-1.86057	0.004959
miR-135b-5p	MIMAT0000758	2.70132	0.00071	miR-214-3p	MIMAT0000271	-1.83757	0.009267
miR-21-3p	MIMAT0004494	2.632962	0.000378	miR-8069	MIMAT0030996	-1.77007	0.001181
miR-200a-5p	MIMAT0001620	2.592559	0.004836	miR-663a	MIMAT0003326	-1.76273	0.001223
miR-96-5p	MIMAT0000095	2.563414	0.000441	miR-497-5p	MIMAT0002820	-1.74511	0.005241
miR-141-3p	MIMAT0000432	2.355117	0.000109	miR-199a-5p	MIMAT0000231	-1.70426	0.005371
miR-301a-3p	MIMAT0000688	2.255996	0.006952	miR-6831-5p	MIMAT0027562	-1.689	6.40E-05
miR-429	MIMAT0001536	2.220221	0.001187	miR-5787	MIMAT0023252	-1.64863	0.000945
miR-149-5p	MIMAT0000450	2.10217	3.42E-05
miR-452-5p	MIMAT0001635	2.093135	0.005571
miR-378a-3p	MIMAT0000732	2.087512	7.69E-05
miR-4286	MIMAT0016916	2.039933	0.000486
miR-21-5p	MIMAT0000076	2.028528	0.001311
miR-200b-5p	MIMAT0004571	2.00426	0.000976
miR-142-5p	MIMAT0000433	1.845882	0.000168
miR-93-5p	MIMAT0000093	1.826103	6.67E-06
miR-1290	MIMAT0005880	1.772368	0.001236
miR-425-5p	MIMAT0003393	1.762644	5.67E-06
miR-455-3p	MIMAT0004784	1.729404	0.000237
miR-200a-3p	MIMAT0000682	1.69094	0.001973
miR-221-3p	MIMAT0000278	1.679623	0.000828
miR-142-3p	MIMAT0000434	1.676354	0.000414
miR-1260a	MIMAT0005911	1.612317	0.000335
miR-34a-5p	MIMAT0000255	1.598804	0.001324

Figure 2.  The qRT-PCR validation of nine differentially expressed miRNAs selected by the microarray assay.

(A) Comparison of miRNA expression levels obtainedby miRNA microarray and qRT-PCR analysis. Upregulated and downregulated miRNAs are indicated by bars above and below the horizontal axis, respectively. (B) Pearson correlation analysis investigating the linear relationship between the microarray data and qRT-PCR results.

qRT-PCR: Quantitative real-time reverse transcription PCR.

Figure 3.  An enrichment analysis of the predicted targets of 58 differentially expressed miRNAs in the SNIP tissues.

(A–C) GO functional enrichment of miRNA potential targets: (A) biological process, (B) molecular fuction, (C) cellular component. (D) Pathway annotation of the target genes of the miRNAs. Ordinate is the significant GO/pathway term (p < 0.05, FDR < 0.05).

Figure 4.  ROC curve analysis used to assess on the accuracy of miR-214-3p in discriminating the SNIP patients.

Figure 5.  Predicted targets of miR-214-3p and their annotated GO and pathway terms.

miR-214-3p is indicated by a red circle. Its target genes are indicated by blue squares. GO and pathway terms are represented by green triangles and yellow diamonds, respectively.

Table 4.  Relationships between clinicopathological characteristics and miR-214-3p expression in patients with sinonasal inverted papilloma.

Parameter	miR-214-3p
	Upregulation^† (%), N = 17	Downregulation^‡ (%>, N = 15	p-value (Fisher’s exact test)
Age:			1.000
– <50 years	6 (35.3)	5 (33.3)
– ≥50 years	11 (64.7)	10  (66.7)
Gender:			0.383
– Male	15 (88.2)	11 (73.3)
– Female	2 (11.8)	4 (26.7)
Smoking status:			0.712
– Yes	12 (70.6)	9 (60.0)
– No	5 (29.4)	6 (40.0)
Tumor staging:^§			0.021
– I + II	15 (88.2)	7 (46.7)
– III + IV	2 (11.8)	8 (53.3)
Recurrence:			0.038
– Yes	0 (0.0)	4 (26.7)
– No	17 (100.0)	11 (73.3)

^†Greater than or equal to 0.17 (average relative expression level of miR-214-3p in 32 patients with sinonasal inverted papilloma).

^‡Less than 0.17.

^§Tumor staging is defined according to a staging system for inverted papilloma described by Krouse (2000).