Biomarkers in the era of personalized medicine – a multiplexed SNP assay using capillary electrophoresis for assessing drug metabolism capacity

Figures & data

Table I. Primer sequences used for this report.

Primer	Sequence (5′ to 3′)
P100	ggcctaccctgggtaagggcctggagcagga
P200	cgcatttgagacaggggtacgttgaggctgag
CYP2D6*2–2856R	cggcagagaacaggtcagccaccactatgc
CYP2D6*2–4181R	ggcacagcacaaagctcatagggggatggg
CYP2D6*3F	acccagctggatgagctgctaactgagcac
CYP2D6*4F	gcgaccccttacccgcatctcccaccccca
CYP2D6*6F	ttgggcctgggcaagaagtcgctggagcag
CYP2D6*7F	tggcctggggcctcctgctcatgatcctac
CYP2D6*8F	tgcctttgtgccgccttcgccaaccactcc

Figure 1. Schematic diagram of the genomic locus of cytochrome P4502D6 and the location of the various SNPs of interest.

Figure 2. Workflow for multiplexed SNP analysis using capillary electrophoresis (right) and length of time required at each step (left).

Figure 3. Schematic diagram of single base extension analysis. An oligonucleotide primer, sequence ending one nucleotide upstream of SNP of interest, is extended by one base with DNA polymerase. Each base if labelled with a different colour fluorophore allowing for interrogation of the SNP of interest at detection.